Fungal Genomics

at Utrecht University

General Properties

Protein IDPro_DTO377G3_2|g7966.t1
Gene name
Locationscaffold_27:284804..285126
Strand+
Gene length (bp)322
Transcript length (bp)246
Coding sequence length (bp)246
Protein length (aa) 82

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

GO

(None)

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
No 1 - 20 0.45

Transmembrane Domains

Domain # Start End Length
1 54 76 22

Transcription Factor Class

(None)

Expression data

Analysis 1: Genome-wide gene expression in conidia of Penicillium roqueforti during growth at various temperatures and for various amounts of time. Published in Punt et al., 2020.

Expression values

Label Description Expression (RPKM) Confidence interval (low) Confidence interval (high)
3d_25C Three days - 25 degrees Celsius 48.08 7.20 88.96
5d_25C Five days - 25 degrees Celsius 67.05 14.46 119.65
7d_25C Seven days - 25 degrees Celsius 51.94 7.72 96.17
10d_25C Ten days - 25 degrees Celsius 72.82 16.69 128.95
7d_15C Seven days - 15 degrees Celsius 112.86 22.19 203.52
7d_30C Seven days - 30 degrees Celsius 1683.08 974.04 2392.11

Differential expression

Label1 Label2 Q-value Significant difference
3d_25C 5d_25C 0.557166 no
3d_25C 7d_25C 0.919493 no
3d_25C 7d_15C 0.074263 no
3d_25C 7d_30C 0.000700 yes
3d_25C 10d_25C 0.436816 no
5d_25C 7d_25C 0.658915 no
5d_25C 7d_15C 0.273053 no
5d_25C 7d_30C 0.000700 yes
5d_25C 10d_25C 0.902542 no
7d_25C 7d_15C 0.100169 no
7d_25C 7d_30C 0.000700 yes
7d_25C 10d_25C 0.530601 no
7d_15C 7d_30C 0.000700 yes
7d_15C 10d_25C 0.377118 no
7d_30C 10d_25C 0.000700 yes

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Pro_DTO377G3_2|g7966.t1
MSAAMGPIMQQLQALPARSRQGLNNLRQRIFQQGERQPREANLLRTSLNVHRPVWITAGGGLYTSMAAVYLTMRY
LKRVAR*
Coding >Pro_DTO377G3_2|g7966.t1
ATGTCGGCAGCCATGGGTCCTATTATGCAGCAGCTGCAGGCTCTCCCTGCCCGCTCGAGGCAGGGTCTGAATAAC
CTACGCCAGCGTATCTTCCAGCAGGGAGAGAGACAACCCAGAGAAGCCAACCTCCTGCGCACCTCCCTCAATGTT
CACCGTCCCGTTTGGATCACTGCTGGCGGCGGTCTGTACACCAGCATGGCAGCGGTCTATCTCACGATGCGATAT
CTGAAGCGTGTTGCTAGGTAG
Transcript >Pro_DTO377G3_2|g7966.t1
ATGTCGGCAGCCATGGGTCCTATTATGCAGCAGCTGCAGGCTCTCCCTGCCCGCTCGAGGCAGGGTCTGAATAAC
CTACGCCAGCGTATCTTCCAGCAGGGAGAGAGACAACCCAGAGAAGCCAACCTCCTGCGCACCTCCCTCAATGTT
CACCGTCCCGTTTGGATCACTGCTGGCGGCGGTCTGTACACCAGCATGGCAGCGGTCTATCTCACGATGCGATAT
CTGAAGCGTGTTGCTAGGTAG
Gene >Pro_DTO377G3_2|g7966.t1
ATGTCGGCAGCCATGGGTCCTATTATGCAGCAGCTGCAGGCTCTCCCTGCCCGCTCGAGGCAGGGTCTGAATAAC
CTACGCCAGCGTATCTTCCAGCAGGGTATGTTCTTACCCCTTGTCTTCCGACCGTCTCATTAACCTTACTCCTGA
TATTCGGATACTAACACTGTTCAAAGGAGAGAGACAACCCAGAGAAGCCAACCTCCTGCGCACCTCCCTCAATGT
TCACCGTCCCGTTTGGATCACTGCTGGCGGCGGTCTGTACACCAGCATGGCAGCGGTCTATCTCACGATGCGATA
TCTGAAGCGTGTTGCTAGGTAG

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail