Fungal Genomics

at Utrecht University

General Properties

Protein IDPro_DTO377G3_2|g4879.t1
Gene name
Locationscaffold_10:628233..628739
Strand-
Gene length (bp)506
Transcript length (bp)264
Coding sequence length (bp)264
Protein length (aa) 88

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF05160 DSS1_SEM1 DSS1/SEM1 family 2.6E-23 18 82

GO

GO Term Description Terminal node
GO:0008541 proteasome regulatory particle, lid subcomplex Yes
GO:0043248 proteasome assembly Yes
GO:0006406 mRNA export from nucleus Yes
GO:0050657 nucleic acid transport No
GO:0046907 intracellular transport No
GO:0006810 transport No
GO:0051028 mRNA transport No
GO:0043933 protein-containing complex organization No
GO:0008150 biological_process No
GO:0005575 cellular_component No
GO:0006913 nucleocytoplasmic transport No
GO:0051234 establishment of localization No
GO:0065003 protein-containing complex assembly No
GO:0016043 cellular component organization No
GO:0051641 cellular localization No
GO:0032991 protein-containing complex No
GO:0071702 organic substance transport No
GO:0051168 nuclear export No
GO:0071840 cellular component organization or biogenesis No
GO:0050658 RNA transport No
GO:0006405 RNA export from nucleus No
GO:0051649 establishment of localization in cell No
GO:0051236 establishment of RNA localization No
GO:0051179 localization No
GO:0022607 cellular component assembly No
GO:0015931 nucleobase-containing compound transport No
GO:0071705 nitrogen compound transport No
GO:0051169 nuclear transport No
GO:0009987 cellular process No

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
No 1 - 51 0.45

Transmembrane Domains

(None)

Transcription Factor Class

(None)

Expression data

Analysis 1: Genome-wide gene expression in conidia of Penicillium roqueforti during growth at various temperatures and for various amounts of time. Published in Punt et al., 2020.

Click here for more information

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Pro_DTO377G3_2|g4879.t1
MSNPTTQKADATEQPAPQAKPQVLEEDDEFEDFPVEDWPQEEAEQANGSTANDGSEHLWEESWDDDDAAEDFSKQ
LQEELKKVEASA*
Coding >Pro_DTO377G3_2|g4879.t1
ATGTCAAACCCAACTACCCAGAAGGCCGATGCCACAGAGCAGCCCGCACCACAAGCGAAGCCCCAAGTCTTGGAG
GAAGACGACGAGTTCGAGGATTTCCCCGTTGAAGACTGGCCCCAAGAAGAAGCCGAGCAGGCCAATGGCTCGACA
GCAAATGACGGTAGCGAGCACCTGTGGGAAGAGAGCTGGGATGACGATGATGCCGCGGAGGACTTCTCAAAGCAG
CTCCAGGAAGAATTGAAGAAAGTCGAAGCATCGGCTTAA
Transcript >Pro_DTO377G3_2|g4879.t1
ATGTCAAACCCAACTACCCAGAAGGCCGATGCCACAGAGCAGCCCGCACCACAAGCGAAGCCCCAAGTCTTGGAG
GAAGACGACGAGTTCGAGGATTTCCCCGTTGAAGACTGGCCCCAAGAAGAAGCCGAGCAGGCCAATGGCTCGACA
GCAAATGACGGTAGCGAGCACCTGTGGGAAGAGAGCTGGGATGACGATGATGCCGCGGAGGACTTCTCAAAGCAG
CTCCAGGAAGAATTGAAGAAAGTCGAAGCATCGGCTTAA
Gene >Pro_DTO377G3_2|g4879.t1
ATGTCAAACCCAACTACCCAGAAGGCCGATGCCACAGAGCAGCCCGCACCACAAGCGAAGCCCCAAGTCTTGGAG
GAAGACGACGAGTTCGAGGATTTCCCCGTTGAAGGTATCGACCAAGCACTCAAGCGCTTCCCTGCAGCAACGAAG
CTAACTCTACGACACACAGACTGGCCCCAAGAAGAAGCCGAGCAGGCCAATGGCTCGACAGCAAATGACGGTAGC
GAGCACCTGTGGGAAGAGAGCTGGGATGACGATGATGCCGCGGAGGACTTCTCAAAGCAGCTCCAGTGAGTTTGC
CTTTCCCAATACTTCCCGATTCTCTGTATACTCTTTATGCTATGCTTCTTGTCCACAAAGTCTCTTTCATCTTTG
AACCAAAACCACCACCGAAGCCCGCACCCCCATCCCCGCCAAAGCTCCCGCCTTCCCCTCTTTCACCGCACCCAC
TAACATCCATCACCTCATCCAGGGAAGAATTGAAGAAAGTCGAAGCATCGGCTTAA

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail