Fungal Genomics

at Utrecht University

General Properties

Protein IDPro_DTO377G3_2|g2018.t1
Gene name
Locationscaffold_02:1434529..1435173
Strand+
Gene length (bp)644
Transcript length (bp)276
Coding sequence length (bp)276
Protein length (aa) 92

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF04418 DUF543 Domain of unknown function (DUF543) 4.7E-27 12 79

GO

GO Term Description Terminal node
GO:0005743 mitochondrial inner membrane Yes
GO:0061617 MICOS complex Yes
GO:0005575 cellular_component No
GO:0044444 cytoplasmic part No
GO:0044464 cell part No
GO:0044446 intracellular organelle part No
GO:0098796 membrane protein complex No
GO:0031966 mitochondrial membrane No
GO:0016020 membrane No
GO:0044422 organelle part No
GO:0044455 mitochondrial membrane part No
GO:0044429 mitochondrial part No
GO:0032991 protein-containing complex No
GO:0044424 intracellular part No
GO:0044425 membrane part No
GO:0098798 mitochondrial protein complex No
GO:0098800 inner mitochondrial membrane protein complex No
GO:0031090 organelle membrane No
GO:0019866 organelle inner membrane No

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
No 1 - 70 0.5

Transmembrane Domains

Domain # Start End Length
1 30 52 22

Transcription Factor Class

(None)

Expression data

Analysis 1: Genome-wide gene expression in conidia of Penicillium roqueforti during growth at various temperatures and for various amounts of time. Published in Punt et al., 2020.

Click here for more information

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Pro_DTO377G3_2|g2018.t1
MAESSESGPIARATKPVSEALLNEKWDRAISSVIIKSSLGLSFGVVFSVLLFKRKAWPAWIGLGFGAGRAWEEAD
ASFRRGDSPIRDALRR*
Coding >Pro_DTO377G3_2|g2018.t1
ATGGCTGAATCCAGTGAATCCGGGCCGATCGCGCGAGCCACCAAGCCCGTCAGCGAAGCTTTGCTTAACGAGAAG
TGGGACCGCGCCATCTCCTCTGTGATCATCAAGTCCTCCCTCGGTCTGTCTTTCGGTGTTGTCTTCTCGGTGCTG
CTCTTCAAGCGGAAGGCTTGGCCCGCGTGGATTGGTCTCGGCTTCGGTGCCGGACGTGCTTGGGAAGAGGCTGAT
GCCTCCTTCCGCCGTGGTGACTCCCCTATCAGAGATGCCCTCCGCCGTTAA
Transcript >Pro_DTO377G3_2|g2018.t1
ATGGCTGAATCCAGTGAATCCGGGCCGATCGCGCGAGCCACCAAGCCCGTCAGCGAAGCTTTGCTTAACGAGAAG
TGGGACCGCGCCATCTCCTCTGTGATCATCAAGTCCTCCCTCGGTCTGTCTTTCGGTGTTGTCTTCTCGGTGCTG
CTCTTCAAGCGGAAGGCTTGGCCCGCGTGGATTGGTCTCGGCTTCGGTGCCGGACGTGCTTGGGAAGAGGCTGAT
GCCTCCTTCCGCCGTGGTGACTCCCCTATCAGAGATGCCCTCCGCCGTTAA
Gene >Pro_DTO377G3_2|g2018.t1
ATGGCTGAATCCAGTGAATCCGGGCCGATCGCGCGAGCCACCAAGCCCGTCAGCGAAGCTTTGCTTAACGAGAAG
GTATGAGCTAGCTGGGATCTTCAAATGGGGAAGTTGCAATATAGAATCATACCATTGATATATATGACAATTGTC
TCGGTCTGGAAGGAAACATGGGAGAACCCGTTGGCTAACCTTTTAACGTCATATAATTAGTGGGACCGCGCCATC
TCCTCTGTGATCATCAAGTCCTCCCTCGGTCTGTCTTTCGGTGTTGTCTTCTCGGTGCTGCTCTTCAAGCGGAAG
GCTTGGCCCGCGTGGATTGGTCTCGGCTTCGGTGCCGGACGTGCTTGGGAAGAGGCTGATGGTACGTTCATCTCT
CTAATTCATTCGGTTCACGGGCATTTAGAGGGGCATTTAGTGAAGTTGGAGCTTCGGGTCACTATAAGATAAGCA
CACTTGAGCTTGGGCAGAGGCTGTATGCTGTAATTTTTTCAGCATCGAGCTTCGTAGGCCCTTCAACAGTGACCC
GACTATCCGCTTTTCTCCGAGCCTACCTATCTCCAAGATCTAAGAATGACTGAGCTAACTTGTACTTAGCCTCCT
TCCGCCGTGGTGACTCCCCTATCAGAGATGCCCTCCGCCGTTAA

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail