Fungal Genomics

at Utrecht University

General Properties

Protein IDOphun1|5765
Gene name
LocationContig_591:7718..8247
Strand-
Gene length (bp)529
Transcript length (bp)291
Coding sequence length (bp)291
Protein length (aa) 97

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF17237 Emr1 ERMES regulator 1 1.6E-14 4 37

Swissprot hits

(None)

GO

GO Term Description Terminal node
GO:0007008 outer mitochondrial membrane organization Yes
GO:0007006 mitochondrial membrane organization No
GO:0007005 mitochondrion organization No
GO:0016043 cellular component organization No
GO:0006996 organelle organization No
GO:0071840 cellular component organization or biogenesis No
GO:0009987 cellular process No
GO:0008150 biological_process No
GO:0061024 membrane organization No

Deeploc

Deeploc data not available for this genome

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup16816
Change Orthofinder run
Species Protein ID
Ophiocordyceps camponoti-rufipedis Ophun1|5765 (this protein)

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophun1|5765
MANFPNLRRLFIEARTDNEERDVSRKAFYNAVLFMGSAPGPESPRAEMWNLYARLSATDETVIVIVLLNGNLEAL
LWMAMIHFSDLDCSFICRPAA*
Coding >Ophun1|5765
ATGGCCAACTTTCCCAACCTCCGCAGGCTCTTCATCGAAGCCAGGACTGATAACGAGGAGAGGGATGTCTCGAGG
AAGGCGTTCTACAACGCCGTCCTGTTCATGGGATCAGCTCCAGGCCCTGAATCACCACGCGCCGAAATGTGGAAT
CTATATGCAAGGCTCAGTGCCACCGATGAGACTGTTATTGTCATCGTCCTTCTGAACGGCAATCTCGAGGCGCTC
CTGTGGATGGCCATGATCCACTTCTCTGATCTGGACTGCTCGTTCATCTGCCGCCCTGCCGCCTAG
Transcript >Ophun1|5765
ATGGCCAACTTTCCCAACCTCCGCAGGCTCTTCATCGAAGCCAGGACTGATAACGAGGAGAGGGATGTCTCGAGG
AAGGCGTTCTACAACGCCGTCCTGTTCATGGGATCAGCTCCAGGCCCTGAATCACCACGCGCCGAAATGTGGAAT
CTATATGCAAGGCTCAGTGCCACCGATGAGACTGTTATTGTCATCGTCCTTCTGAACGGCAATCTCGAGGCGCTC
CTGTGGATGGCCATGATCCACTTCTCTGATCTGGACTGCTCGTTCATCTGCCGCCCTGCCGCCTAG
Gene >Ophun1|5765
ATGGTACTGGAGGTATACCTCGTGGGCAGAGACCCCGGGCTGACCAGCATCTCCCAGGCCAACTTTCCCAACCTC
CGCAGGCTCTTCATCGAAGCCAGGACTGATAACGAGGAGAGGGATGTCTCGAGGAAGGCGGTACGTCTGGAAGAA
TATCGCGGCTTTTGCTTAGACTTGATCTGAACACAGCTGATGGCTTGACTTTAGTTCTACAACGCCGTCCTGTTC
ATGGGATCAGTCGCCGTCTTCAGCCTCATCGCTCAAAAACTAAATGCGGGAAGATGGGCACATTCACTTCAATAA
ATCCCTGCCATGGTCTGCAGAGCCTCGCTTCATGTCATCGCCGCGATAGGCTCCAGGCCCTGAATCACCACGCGC
CGAAATGTGGAATCTATATGCAAGGCTCAGTGCCACCGATGAGACTGTTATTGTCATCGTCCTTCTGAACGGCAA
TCTCGAGGCGCTCCTGTGGATGGCCATGATCCACTTCTCTGATCTGGACTGCTCGTTCATCTGCCGCCCTGCCGC
CTAG

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail