Fungal Genomics

at Utrecht University

General Properties

Protein IDOphun1|3541
Gene name
LocationContig_315:16860..17394
Strand+
Gene length (bp)534
Transcript length (bp)264
Coding sequence length (bp)264
Protein length (aa) 88

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

Swissprot hits

(None)

GO

(None)

Deeploc

Deeploc data not available for this genome

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup1560
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|5671
Ophiocordyceps australis map64 (Brazil) OphauB2|2406
Ophiocordyceps camponoti-floridani Ophcf2|00139
Ophiocordyceps camponoti-rufipedis Ophun1|3541 (this protein)
Ophiocordyceps kimflemingae Ophio5|3798
Ophiocordyceps subramaniannii Hirsu2|1140

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophun1|3541
MSNQEYYGGGGGGYPQHPQPSYGPPQGNYGPPQGYNGGYQQGQPPMQYQQAPPQNDSRGRRGGSNNCLMAYTTIY
TFISPLRKSLVV*
Coding >Ophun1|3541
ATGTCTAACCAGGAATACTATGGCGGTGGTGGTGGTGGCTATCCGCAGCATCCTCAACCCAGCTACGGTCCGCCG
CAGGGAAACTATGGCCCTCCCCAGGGATACAACGGCGGCTATCAACAAGGCCAGCCCCCGATGCAGTACCAACAG
GCCCCCCCTCAAAACGACTCTCGCGGTCGCCGCGGTGGAAGCAACAACTGCCTGATGGCATACACCACCATCTAC
ACCTTCATCTCCCCGCTGCGGAAAAGTCTCGTTGTCTGA
Transcript >Ophun1|3541
ATGTCTAACCAGGAATACTATGGCGGTGGTGGTGGTGGCTATCCGCAGCATCCTCAACCCAGCTACGGTCCGCCG
CAGGGAAACTATGGCCCTCCCCAGGGATACAACGGCGGCTATCAACAAGGCCAGCCCCCGATGCAGTACCAACAG
GCCCCCCCTCAAAACGACTCTCGCGGTCGCCGCGGTGGAAGCAACAACTGCCTGATGGCATACACCACCATCTAC
ACCTTCATCTCCCCGCTGCGGAAAAGTCTCGTTGTCTGA
Gene >Ophun1|3541
ATGTCTAACCAGGAATACTATGGCGGTGGTGGTGGTGGCTATCCGCAGCATCCTCAACCCGTAAGTCGCCTCGTC
GTGGTGACGCTGTTGATGGCTCCATCATCTCTGTGTGCCAGAATCATTATCGTCATCATCATCGTTCAGGTCCCG
CCATTGAGCCATTCAAGCGAGCGCCCTGTTTTCCCTACCACGAAGAACAACAAGAAAACCATCGTGACATGAGAC
CTCACTCGCTGACCCAGCCTCTCTTTCCCCCCATCTAGAGCTACGGTCCGCCGCAGGGAAACTATGGCCCTCCCC
AGGGATACAACGGCGGCTATCAACAAGGCCAGCCCCCGATGCAGTACCAACAGGCCCCCCCTCAAAACGACTCTC
GCGGTCGCCGCGGTGGAAGCAACAACTGCCTGATGGCATGTCTGGCCGCGCTTTGCTGCTGCTGCGTCGCCGAAG
AGGGCTGCGAATGCTGGTGCGTCTTGGACAGACACCACCATCTACACCTTCATCTCCCCGCTGCGGAAAAGTCTC
GTTGTCTGA

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail