Fungal Genomics

at Utrecht University

General Properties

Protein IDOphun1|2228
Gene name
LocationContig_206:19837..20214
Strand-
Gene length (bp)377
Transcript length (bp)243
Coding sequence length (bp)243
Protein length (aa) 81

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF01200 Ribosomal_S28e Ribosomal protein S28e 1.7E-06 60 79

Swissprot hits

[Show all]
Swissprot ID Swissprot Description Start End E-value
sp|Q7S6W5|RS28_NEUCR 40S ribosomal protein S28 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=rps-28 PE=3 SV=1 1 80 4.0E-13
sp|P0CT80|RS28B_SCHPO 40S ribosomal protein S28-B OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=rps2802 PE=3 SV=1 1 80 5.0E-11
sp|P0CT79|RS28A_SCHPO 40S ribosomal protein S28-A OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=rps2801 PE=3 SV=1 1 80 5.0E-11
sp|P62859|RS28_RAT 40S ribosomal protein S28 OS=Rattus norvegicus GN=Rps28 PE=1 SV=1 1 80 5.0E-09
sp|Q6QAT1|RS28_PIG 40S ribosomal protein S28 OS=Sus scrofa GN=RPS28 PE=1 SV=2 1 80 5.0E-09
[Show all]
[Show less]
Swissprot ID Swissprot Description Start End E-value
sp|Q7S6W5|RS28_NEUCR 40S ribosomal protein S28 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=rps-28 PE=3 SV=1 1 80 4.0E-13
sp|P0CT80|RS28B_SCHPO 40S ribosomal protein S28-B OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=rps2802 PE=3 SV=1 1 80 5.0E-11
sp|P0CT79|RS28A_SCHPO 40S ribosomal protein S28-A OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=rps2801 PE=3 SV=1 1 80 5.0E-11
sp|P62859|RS28_RAT 40S ribosomal protein S28 OS=Rattus norvegicus GN=Rps28 PE=1 SV=1 1 80 5.0E-09
sp|Q6QAT1|RS28_PIG 40S ribosomal protein S28 OS=Sus scrofa GN=RPS28 PE=1 SV=2 1 80 5.0E-09
sp|P62858|RS28_MOUSE 40S ribosomal protein S28 OS=Mus musculus GN=Rps28 PE=1 SV=1 1 80 5.0E-09
sp|P62857|RS28_HUMAN 40S ribosomal protein S28 OS=Homo sapiens GN=RPS28 PE=1 SV=1 1 80 5.0E-09
sp|Q56JX6|RS28_BOVIN 40S ribosomal protein S28 OS=Bos taurus GN=RPS28 PE=3 SV=1 1 80 5.0E-09
sp|Q54MZ5|RS28_DICDI 40S ribosomal protein S28 OS=Dictyostelium discoideum GN=rps28 PE=3 SV=1 1 80 1.0E-08
sp|Q90YP3|RS28_ICTPU 40S ribosomal protein S28 OS=Ictalurus punctatus GN=rps28 PE=3 SV=1 1 80 2.0E-08
sp|Q6PBK3|RS28_DANRE 40S ribosomal protein S28 OS=Danio rerio GN=rps28 PE=3 SV=1 1 80 2.0E-08
sp|Q74ZD8|RS28_ASHGO 40S ribosomal protein S28 OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) GN=RPS28A PE=3 SV=1 4 80 1.0E-07
sp|P0C0X0|RS28B_YEAST 40S ribosomal protein S28-B OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS28B PE=1 SV=1 4 80 4.0E-07
sp|P33285|RS28_KLULA 40S ribosomal protein S28 OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=RPS28 PE=1 SV=1 1 80 5.0E-07
sp|Q3E7X9|RS28A_YEAST 40S ribosomal protein S28-A OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS28A PE=1 SV=1 5 80 7.0E-07
sp|P33286|RS28_KLUMA 40S ribosomal protein S28 OS=Kluyveromyces marxianus GN=RPS28 PE=3 SV=1 4 80 1.0E-06
sp|Q6FLC3|RS28_CANGA 40S ribosomal protein S28 OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) GN=RPS28A PE=3 SV=1 5 80 2.0E-06
[Show less]

GO

GO Term Description Terminal node
GO:0003735 structural constituent of ribosome Yes
GO:0006412 translation Yes
GO:0005840 ribosome Yes
GO:0043043 peptide biosynthetic process No
GO:0043226 organelle No
GO:0043229 intracellular organelle No
GO:0043170 macromolecule metabolic process No
GO:1901576 organic substance biosynthetic process No
GO:0044271 cellular nitrogen compound biosynthetic process No
GO:0044260 cellular macromolecule metabolic process No
GO:0019538 protein metabolic process No
GO:0006518 peptide metabolic process No
GO:0008152 metabolic process No
GO:0009058 biosynthetic process No
GO:0009987 cellular process No
GO:0005198 structural molecule activity No
GO:0044238 primary metabolic process No
GO:0044237 cellular metabolic process No
GO:0043232 intracellular non-membrane-bounded organelle No
GO:0006807 nitrogen compound metabolic process No
GO:0110165 cellular anatomical entity No
GO:0043228 non-membrane-bounded organelle No
GO:0005575 cellular_component No
GO:0044249 cellular biosynthetic process No
GO:0003674 molecular_function No
GO:0034641 cellular nitrogen compound metabolic process No
GO:1901564 organonitrogen compound metabolic process No
GO:1901566 organonitrogen compound biosynthetic process No
GO:0008150 biological_process No
GO:0009059 macromolecule biosynthetic process No
GO:0071704 organic substance metabolic process No
GO:0034645 cellular macromolecule biosynthetic process No
GO:0043604 amide biosynthetic process No
GO:0043603 cellular amide metabolic process No

Deeploc

Deeploc data not available for this genome

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup4962
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|974
Ophiocordyceps australis map64 (Brazil) OphauB2|7421
Ophiocordyceps camponoti-floridani Ophcf2|06194
Ophiocordyceps camponoti-rufipedis Ophun1|2228 (this protein)
Ophiocordyceps kimflemingae Ophio5|6426
Ophiocordyceps subramaniannii Hirsu2|1995

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophun1|2228
MDTAKNPSKLVKVTRVLGRTGTDSPATWGKNTAVLRGLEWDFERTEMADEDFRLARWRYAVREDDILCLLESERE
ARRLR*
Coding >Ophun1|2228
ATGGATACCGCCAAGAATCCCAGCAAGCTGGTCAAGGTGACGCGTGTCCTTGGCCGTACCGGTACGGACTCTCCG
GCTACCTGGGGAAAGAATACAGCCGTGCTGCGCGGCTTGGAGTGGGATTTTGAGAGGACGGAGATGGCTGACGAG
GACTTTAGGCTCGCGCGGTGGCGTTACGCAGTCCGCGAAGACGACATCCTGTGCCTCCTCGAGTCGGAGCGTGAA
GCCAGACGGTTGCGATAA
Transcript >Ophun1|2228
ATGGATACCGCCAAGAATCCCAGCAAGCTGGTCAAGGTGACGCGTGTCCTTGGCCGTACCGGTACGGACTCTCCG
GCTACCTGGGGAAAGAATACAGCCGTGCTGCGCGGCTTGGAGTGGGATTTTGAGAGGACGGAGATGGCTGACGAG
GACTTTAGGCTCGCGCGGTGGCGTTACGCAGTCCGCGAAGACGACATCCTGTGCCTCCTCGAGTCGGAGCGTGAA
GCCAGACGGTTGCGATAA
Gene >Ophun1|2228
ATGGATACCGCCAAGAATCCCAGCAAGCTGGTCAAGGTGACGCGTGTCCTTGGCCGTACCGGTACGGACTCTCCG
GCTACCTGGGGAAAGAATACAGCCGTGCTGCGCGGCTTGGAGTGGGATTTTGAGAGGACGGAGATGGCTGACGAG
GACTTTAGGCTCGCGCGGTGGCGTTACGCAGGTGCGCGTCGAGTTCATGGATGACCAGAGCCGGTCTATTATCCG
AAACGTCAAAGGCGCTGGTATGACTACCGACCTGGACCGCCCTCTGCCATACTCTCCTTGTATCGATCTTGAACT
GACGTTTCTCTATAGTCCGCGAAGACGACATCCTGTGCCTCCTCGAGTCGGAGCGTGAAGCCAGACGGTTGCGAT
AA

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail