Fungal Genomics

at Utrecht University

General Properties

Protein IDOphio5|803
Gene name
Locationscaffold_1221:1441..2195
Strand-
Gene length (bp)754
Transcript length (bp)582
Coding sequence length (bp)579
Protein length (aa) 193

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF02178 AT_hook AT hook motif 3.9E-01 15 24
PF02178 AT_hook AT hook motif 1.6E+00 39 50
PF02178 AT_hook AT hook motif 4.8E-02 101 111
PF02178 AT_hook AT hook motif 1.1E-01 122 132

Swissprot hits

(None)

GO

GO Term Description Terminal node
GO:0003677 DNA binding Yes
GO:0003676 nucleic acid binding No
GO:0097159 organic cyclic compound binding No
GO:0005488 binding No
GO:0003674 molecular_function No
GO:1901363 heterocyclic compound binding No

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
No 1 - 69 0.45

Transmembrane Domains

(None)

Transcription Factor Class

(None)

Expression data

Analysis 1: Expression analysis during behavioral modification. Published in De Bekker et al., 2017.

Click here for more information

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophio5|803
MARTKEEATGESTAPRGRGRPPGTTTTTTSDAGVKKPTGRGRGRPKSDKSKADSKAKPYVPTGRPRGRPKGSGKK
KTGTATATTATATAATATTSSATKGTGKRGRPRKSDAAAADTPKPAKGKRGRPPKKSLEAQPEPKADDDDDDDVD
VDVDVDADAEPLSDHAEDSIDDAPINQEHLAVESGEESDDMLD
Coding >Ophio5|803
ATGGCGCGCACCAAGGAAGAGGCAACTGGCGAGTCGACGGCCCCCCGCGGTCGAGGCAGACCTCCCGGCACCACG
ACGACGACGACGAGCGACGCGGGAGTCAAGAAGCCGACGGGCCGTGGACGAGGTCGTCCTAAAAGTGATAAGTCC
AAGGCTGACAGTAAGGCCAAGCCTTATGTCCCCACTGGTCGTCCTCGTGGTCGTCCCAAGGGTAGTGGCAAGAAG
AAGACGGGTACGGCTACGGCTACCACTGCTACCGCTACGGCTGCTACGGCTACCACCTCGTCTGCTACCAAGGGC
ACCGGCAAAAGAGGAAGACCTCGCAAGTCGGACGCTGCCGCTGCCGATACCCCCAAGCCGGCAAAGGGAAAGAGG
GGCCGTCCCCCCAAGAAGTCGCTCGAGGCCCAGCCCGAGCCCAAGGCGGATGATGACGACGACGACGACGTCGAC
GTCGACGTCGACGTCGACGCCGATGCCGAGCCGCTGTCGGATCACGCTGAAGATTCCATCGACGATGCCCCCATC
AATCAGGAACATCTTGCCGTCGAGTCAGGAGAGGAGTCTGATGATATGCTCGAT
Transcript >Ophio5|803
ATGGCGCGCACCAAGGAAGAGGCAACTGGCGAGTCGACGGCCCCCCGCGGTCGAGGCAGACCTCCCGGCACCACG
ACGACGACGACGAGCGACGCGGGAGTCAAGAAGCCGACGGGCCGTGGACGAGGTCGTCCTAAAAGTGATAAGTCC
AAGGCTGACAGTAAGGCCAAGCCTTATGTCCCCACTGGTCGTCCTCGTGGTCGTCCCAAGGGTAGTGGCAAGAAG
AAGACGGGTACGGCTACGGCTACCACTGCTACCGCTACGGCTGCTACGGCTACCACCTCGTCTGCTACCAAGGGC
ACCGGCAAAAGAGGAAGACCTCGCAAGTCGGACGCTGCCGCTGCCGATACCCCCAAGCCGGCAAAGGGAAAGAGG
GGCCGTCCCCCCAAGAAGTCGCTCGAGGCCCAGCCCGAGCCCAAGGCGGATGATGACGACGACGACGACGTCGAC
GTCGACGTCGACGTCGACGCCGATGCCGAGCCGCTGTCGGATCACGCTGAAGATTCCATCGACGATGCCCCCATC
AATCAGGAACATCTTGCCGTCGAGTCAGGAGAGGAGTCTGATGATATGCTCGATTGA
Gene >Ophio5|803
ATGGCGCGCACCAAGGAAGAGGCAACTGGCGAGTCGACGGCCCCCCGCGGTCGAGGCAGACCTCCCGGCACCACG
ACGACGACGACGAGCGACGCGGGAGTCAAGAAGCCGACGGGCCGTGGACGAGGTCGTCCTAAAAGTGATAAGTCC
AAGGCTGACAGTAAGGCCAAGCCTTATGTCCCCACTGGTCGTCCTCGTGGTCGTCCCAAGGGTAGTGGCAAGAAG
AAGACGGGTACGGCTACGGCTACCACTGCTACCGCTACGGCTGCTACGGCTACCACCTCGTCTGCTACCAAGGGC
ACCGGCAAAAGAGGAAGACCTCGCAAGTCGGACGCTGCCGCTGCCGATACCCCCAAGCCGGCAAAGGGAAAGAGG
GGCCGTCCCCCCAAGAAGTCGCTCGAGGCCCAGCCCGAGCCCAAGGCGGATGATGACGACGACGACGACGTCGAC
GTCGACGTCGACGTCGACGCCGATGCCGAGCCGCTGTCGGATCACGCTGAAGGTGAGTTTTGGGCTGCCCCATCG
TCGTCGTCTTTTCAAAAACATGCTCTCTTTTAGCTAACCATGGCTCTCAACTTCCCCCCTCCCTCCCTTTCGCAG
ATTCCATCGACGATGCCCCCATCAATCAGGAACATCTTGCCGTCGAGTCAGGAGAGGTTGGTTCTTCAAATTTGG
TTCGGGTCCTTGACATCGAGATCATGTTTGGCTAATGCTTTTTGGTTTCCTTTAGGAGTCTGATGATATGCTCGA
TTGA

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail