Fungal Genomics

at Utrecht University

General Properties

Protein IDOphio5|3623
Gene name
Locationscaffold_286:17277..17736
Strand+
Gene length (bp)459
Transcript length (bp)459
Coding sequence length (bp)456
Protein length (aa) 152

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

Swissprot hits

(None)

GO

(None)

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
Yes 1 - 17 0.45

Transmembrane Domains

(None)

Transcription Factor Class

(None)

Expression data

Analysis 1: Expression analysis during behavioral modification. Published in De Bekker et al., 2017.

Expression values

Label Description Expression (RPKM) Confidence interval (low) Confidence interval (high)
SC16a Pure fungal culture 9.31 1.45 17.18
CcL In ants, during behavior modification 7.12 0.30 13.95
CcD In ants, recently dead 4.75 0.00 9.59

Differential expression

Label1 Label2 Q-value Significant difference
SC16a CcL 0.588281 no
SC16a CcD 0.155092 no
CcL CcD 0.458879 no

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophio5|3623
MRFLAIVISFVSLALARPISMKEAYDQAAPSHCESTTSWDDSVISTENRYETIENRLRQMNRSRFCTERIQAFSF
HERHHMTKAGCLTIVEEHCSEYDEIQDLYECVDRYVKRHRFAVNEPSPTDSFSENPDMEPAEQEGSKLEGEEWNT
DH
Coding >Ophio5|3623
ATGAGGTTTCTCGCCATCGTCATTTCCTTTGTCAGCCTGGCCCTCGCCAGGCCCATCTCCATGAAGGAGGCCTAC
GATCAGGCTGCGCCTAGCCACTGCGAGTCAACGACATCGTGGGATGACAGCGTCATATCAACTGAGAATAGATAT
GAGACAATTGAGAACAGGCTTAGACAGATGAACCGCTCCCGTTTCTGCACCGAGCGTATCCAGGCTTTTTCCTTT
CATGAAAGGCATCACATGACCAAGGCCGGTTGCTTAACCATCGTCGAGGAGCACTGCAGTGAATACGACGAGATA
CAGGACTTGTATGAATGCGTGGACCGATACGTGAAAAGGCATAGATTCGCCGTCAACGAGCCGTCTCCAACGGAT
TCGTTTTCCGAGAACCCTGATATGGAGCCAGCCGAGCAGGAGGGTAGCAAATTAGAGGGAGAGGAGTGGAATACA
GATCAC
Transcript >Ophio5|3623
ATGAGGTTTCTCGCCATCGTCATTTCCTTTGTCAGCCTGGCCCTCGCCAGGCCCATCTCCATGAAGGAGGCCTAC
GATCAGGCTGCGCCTAGCCACTGCGAGTCAACGACATCGTGGGATGACAGCGTCATATCAACTGAGAATAGATAT
GAGACAATTGAGAACAGGCTTAGACAGATGAACCGCTCCCGTTTCTGCACCGAGCGTATCCAGGCTTTTTCCTTT
CATGAAAGGCATCACATGACCAAGGCCGGTTGCTTAACCATCGTCGAGGAGCACTGCAGTGAATACGACGAGATA
CAGGACTTGTATGAATGCGTGGACCGATACGTGAAAAGGCATAGATTCGCCGTCAACGAGCCGTCTCCAACGGAT
TCGTTTTCCGAGAACCCTGATATGGAGCCAGCCGAGCAGGAGGGTAGCAAATTAGAGGGAGAGGAGTGGAATACA
GATCACTGA
Gene >Ophio5|3623
ATGAGGTTTCTCGCCATCGTCATTTCCTTTGTCAGCCTGGCCCTCGCCAGGCCCATCTCCATGAAGGAGGCCTAC
GATCAGGCTGCGCCTAGCCACTGCGAGTCAACGACATCGTGGGATGACAGCGTCATATCAACTGAGAATAGATAT
GAGACAATTGAGAACAGGCTTAGACAGATGAACCGCTCCCGTTTCTGCACCGAGCGTATCCAGGCTTTTTCCTTT
CATGAAAGGCATCACATGACCAAGGCCGGTTGCTTAACCATCGTCGAGGAGCACTGCAGTGAATACGACGAGATA
CAGGACTTGTATGAATGCGTGGACCGATACGTGAAAAGGCATAGATTCGCCGTCAACGAGCCGTCTCCAACGGAT
TCGTTTTCCGAGAACCCTGATATGGAGCCAGCCGAGCAGGAGGGTAGCAAATTAGAGGGAGAGGAGTGGAATACA
GATCACTGA

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail