Fungal Genomics

at Utrecht University

General Properties

Protein IDOphio5|1497
Gene name
Locationscaffold_152:33572..34162
Strand-
Gene length (bp)590
Transcript length (bp)381
Coding sequence length (bp)378
Protein length (aa) 126

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

Swissprot hits

(None)

GO

(None)

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
No 1 - 47 0.45

Transmembrane Domains

Domain # Start End Length
1 34 51 17
2 61 83 22
3 90 112 22

Transcription Factor Class

(None)

Expression data

Analysis 1: Expression analysis during behavioral modification. Published in De Bekker et al., 2017.

Expression values

Label Description Expression (RPKM) Confidence interval (low) Confidence interval (high)
SC16a Pure fungal culture 30.33 8.52 52.15
CcL In ants, during behavior modification 26.82 6.30 47.33
CcD In ants, recently dead 24.48 6.53 42.42

Differential expression

Label1 Label2 Q-value Significant difference
SC16a CcL 0.779848 no
SC16a CcD 0.591746 no
CcL CcD 0.842165 no

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophio5|1497
MNHNYRVNQEDPLLRTPPDITSRITRLKGRYRRGAVLAAAFDLSTALDRALESPEAAAAAAAAAAAAAAAAAAAL
VVAAAVVVAVVADVVVVVVGVVVVVVVVAAAAAAAAAAAAALQAAAMTWSS
Coding >Ophio5|1497
ATGAACCACAATTACAGAGTGAATCAAGAGGATCCATTACTTCGTACACCTCCAGATATCACCAGCCGCATTACC
AGACTGAAAGGCCGATACCGCCGCGGCGCTGTGCTAGCCGCGGCATTCGATCTCTCGACGGCTTTGGACCGTGCC
CTAGAGTCACCCGAGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCTT
GTGGTTGCTGCTGCGGTTGTTGTTGCTGTTGTTGCTGATGTTGTTGTTGTTGTTGTTGGTGTTGTTGTTGTTGTT
GTTGTTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTCTGCAAGCTGCGGCGATGACGTGGAGC
TCC
Transcript >Ophio5|1497
ATGAACCACAATTACAGAGTGAATCAAGAGGATCCATTACTTCGTACACCTCCAGATATCACCAGCCGCATTACC
AGACTGAAAGGCCGATACCGCCGCGGCGCTGTGCTAGCCGCGGCATTCGATCTCTCGACGGCTTTGGACCGTGCC
CTAGAGTCACCCGAGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCTT
GTGGTTGCTGCTGCGGTTGTTGTTGCTGTTGTTGCTGATGTTGTTGTTGTTGTTGTTGGTGTTGTTGTTGTTGTT
GTTGTTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTCTGCAAGCTGCGGCGATGACGTGGAGC
TCCTGA
Gene >Ophio5|1497
ATGAACCACAATTACAGAGTGAATCAAGAGGATCCATTACTTCGTACACCTCCAGATATCACCAGCCGCATTACC
AGGTATCAGTCATCGCAAATCACAACACAAACCATGAACCATCCAAGCCATCCTCTAACCTCGCCAACCATCACC
ACCCCATCCTCCCCCAACATAGCCCACCGCGTGTGCTCCCACCCTTCCATCATCGCGACGAGGCTGACCGCGCGC
GTCAGACTGAAAGGCCGATACCGCCGCGGCGTACCTCATCGAATCGCCCGCGTTGTGAAGACCAGACGTCGTGAC
CGGCGCTACAGGCTGTGCTAGCCGCGGCATTCGATCTCTCGACGGCTTTGGACCGTGCCCTAGAGTCACCCGAGG
CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCGCTTGTGGTTGCTGCTGCGG
TTGTTGTTGCTGTTGTTGCTGATGTTGTTGTTGTTGTTGTTGGTGTTGTTGTTGTTGTTGTTGTTGTTGCTGCTG
CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTCTGCAAGCTGCGGCGATGACGTGGAGCTCCTGA

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail