Fungal Genomics

at Utrecht University

General Properties

Protein IDOphcf2|05339
Gene name
Locationscaffold_05:3349884..3350352
Strand-
Gene length (bp)468
Transcript length (bp)342
Coding sequence length (bp)342
Protein length (aa) 114

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

GO

(None)

Deeploc

[Help with interpreting the results of Deeploc 2.0]
Localizations Signals Cytoplasm Nucleus Extracellular Cell membrane Mitochondrion Plastid Endoplasmic reticulum Lysosome vacuole Golgi apparatus Peroxisome
Cytoplasm 0.4974 0.3067 0.089 0.1385 0.5167 0.2435 0.5214 0.4108 0.4335 0.1979

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

Analysis 1: Expression analysis during behavioral modification. Published in: Will et al., G3, 2020

Click here for more information

Orthologs

Orthofinder run ID4
Orthogroup6343
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|4916
Ophiocordyceps australis map64 (Brazil) OphauB2|1664
Ophiocordyceps camponoti-floridani Ophcf2|05339 (this protein)
Ophiocordyceps camponoti-rufipedis Ophun1|212
Ophiocordyceps kimflemingae Ophio5|4912

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophcf2|05339
MASWYSSILTKTTSHISSLRATLLSSDADGEDDDDTHAPAPVAAPTPAQQIAPVGSRYGVPQSQSQPGGGLSSLW
DSGGQQQQQQQQQQQQQRGRWGERWNNSWWDGVFVGAG*
Coding >Ophcf2|05339
ATGGCGTCGTGGTACTCGTCCATCCTCACAAAGACAACCTCGCACATCTCCTCCCTCCGCGCAACGCTCCTCTCC
TCCGACGCCGACGGCGAAGACGACGACGATACCCACGCCCCCGCGCCTGTTGCAGCCCCTACGCCCGCCCAGCAG
ATTGCCCCCGTGGGATCACGATATGGCGTTCCGCAGTCGCAGTCTCAGCCGGGAGGTGGTCTGAGCAGCCTCTGG
GATAGCGGCGGGCAACAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGAGGGGGCGGTGGGGGGAGCGCTGG
AATAATAGCTGGTGGGATGGCGTCTTCGTCGGCGCAGGATAG
Transcript >Ophcf2|05339
ATGGCGTCGTGGTACTCGTCCATCCTCACAAAGACAACCTCGCACATCTCCTCCCTCCGCGCAACGCTCCTCTCC
TCCGACGCCGACGGCGAAGACGACGACGATACCCACGCCCCCGCGCCTGTTGCAGCCCCTACGCCCGCCCAGCAG
ATTGCCCCCGTGGGATCACGATATGGCGTTCCGCAGTCGCAGTCTCAGCCGGGAGGTGGTCTGAGCAGCCTCTGG
GATAGCGGCGGGCAACAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGAGGGGGCGGTGGGGGGAGCGCTGG
AATAATAGCTGGTGGGATGGCGTCTTCGTCGGCGCAGGATAG
Gene >Ophcf2|05339
ATGGCGTCGTGGTACTCGTCCATCCTCACAAAGACAACCTCGCACATCTCCTCCCTCCGCGCAACGCTCCTCTCC
TCCGACGCCGACGGCGAAGACGACGACGATACCCACGTCTGTCGCGTCCTCCGGAATTACTACGCTGACAAGGGC
CGGCCCCTCCTCCTGGCTACCCCCCGACCCTAAGGCCCCCGCGCCTGTTGCAGCCCCTACGCCCGCCCAGCAGAT
TGCCCCCGTGGGATCACGATATGGCGTTCCGCAGTCGCAGTCTCAGCCGGGAGGTGGTCTGAGCAGCCTCTGGGA
TAGCGGCGGGCAACAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGAGGGGGCGGTGGGGGGAGCGCTGGAA
TAATAGTCTTGGGCCACTGAGGCCGAATCTGGGGGCCCAGAGGGCCGGGTCGTATCAGGCTGGTGGGATGGCGTC
TTCGTCGGCGCAGGATAG

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail