Fungal Genomics

at Utrecht University

General Properties

Protein IDOphcf2|02050
Gene name
Locationscaffold_02:2479029..2479311
Strand+
Gene length (bp)282
Transcript length (bp)282
Coding sequence length (bp)282
Protein length (aa) 94

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

GO

(None)

Deeploc

[Help with interpreting the results of Deeploc 2.0]
Localizations Signals Cytoplasm Nucleus Extracellular Cell membrane Mitochondrion Plastid Endoplasmic reticulum Lysosome vacuole Golgi apparatus Peroxisome
Cytoplasm 0.6501 0.3643 0.0532 0.2092 0.2579 0.0127 0.1236 0.2666 0.2511 0.0117

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

Analysis 1: Expression analysis during behavioral modification. Published in: Will et al., G3, 2020

Click here for more information

Orthologs

Orthofinder run ID4
Orthogroup4970
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|332
Ophiocordyceps australis map64 (Brazil) OphauB2|5313
Ophiocordyceps camponoti-floridani Ophcf2|02050 (this protein)
Ophiocordyceps camponoti-floridani Ophcf2|07439
Ophiocordyceps camponoti-rufipedis Ophun1|7012
Ophiocordyceps subramaniannii Hirsu2|2082

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophcf2|02050
MEAPVSSPLHSRTSSAATTTMTTTTTTTTTTTTTSSSTIATNATTVPSTMLSAPSPPPPSTSDLLRDLSLVAEAA
KRAQVAVLVRDFEDCGLA*
Coding >Ophcf2|02050
ATGGAAGCCCCCGTCTCATCACCTCTACACTCGCGCACGTCGTCAGCGGCCACGACGACGATGACGACGACGACG
ACGACGACGACGACGACGACGACGACTTCATCATCAACAATAGCGACGAACGCGACAACCGTCCCTTCGACGATG
CTGTCGGCGCCTTCACCCCCCCCGCCCTCAACCTCAGATCTCCTCCGCGACCTCAGCCTCGTGGCCGAAGCCGCC
AAGCGCGCGCAGGTAGCCGTCCTGGTTCGCGACTTTGAGGACTGTGGCCTCGCTTAG
Transcript >Ophcf2|02050
ATGGAAGCCCCCGTCTCATCACCTCTACACTCGCGCACGTCGTCAGCGGCCACGACGACGATGACGACGACGACG
ACGACGACGACGACGACGACGACGACTTCATCATCAACAATAGCGACGAACGCGACAACCGTCCCTTCGACGATG
CTGTCGGCGCCTTCACCCCCCCCGCCCTCAACCTCAGATCTCCTCCGCGACCTCAGCCTCGTGGCCGAAGCCGCC
AAGCGCGCGCAGGTAGCCGTCCTGGTTCGCGACTTTGAGGACTGTGGCCTCGCTTAG
Gene >Ophcf2|02050
ATGGAAGCCCCCGTCTCATCACCTCTACACTCGCGCACGTCGTCAGCGGCCACGACGACGATGACGACGACGACG
ACGACGACGACGACGACGACGACGACTTCATCATCAACAATAGCGACGAACGCGACAACCGTCCCTTCGACGATG
CTGTCGGCGCCTTCACCCCCCCCGCCCTCAACCTCAGATCTCCTCCGCGACCTCAGCCTCGTGGCCGAAGCCGCC
AAGCGCGCGCAGGTAGCCGTCCTGGTTCGCGACTTTGAGGACTGTGGCCTCGCTTAG

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail