Fungal Genomics

at Utrecht University

General Properties

Protein IDOphcf2|01542
Gene name
Locationscaffold_01:5279260..5280305
Strand+
Gene length (bp)1045
Transcript length (bp)924
Coding sequence length (bp)924
Protein length (aa) 308

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF00240 ubiquitin Ubiquitin family 1.6E-32 3 74
PF00240 ubiquitin Ubiquitin family 1.6E-32 79 150
PF00240 ubiquitin Ubiquitin family 1.6E-32 155 226
PF00240 ubiquitin Ubiquitin family 1.6E-32 231 302
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 1.6E-15 1 71
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 1.6E-15 77 147
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 1.6E-15 153 223
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 1.6E-15 229 299
PF14560 Ubiquitin_2 Ubiquitin-like domain 1.0E-03 12 69
PF14560 Ubiquitin_2 Ubiquitin-like domain 9.3E-04 87 145
PF14560 Ubiquitin_2 Ubiquitin-like domain 9.3E-04 163 221
PF14560 Ubiquitin_2 Ubiquitin-like domain 9.3E-04 239 297
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.5E-01 15 71
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.4E-01 89 147
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.4E-01 165 223
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.4E-01 241 299

GO

GO Term Description Terminal node
GO:0005515 protein binding Yes
GO:0005488 binding No
GO:0003674 molecular_function No

Deeploc

[Help with interpreting the results of Deeploc 2.0]
Localizations Signals Cytoplasm Nucleus Extracellular Cell membrane Mitochondrion Plastid Endoplasmic reticulum Lysosome vacuole Golgi apparatus Peroxisome
Cytoplasm|Nucleus Nuclear localization signal|Nuclear export signal 0.7367 0.7382 0.3774 0.1962 0.0663 0.0011 0.0835 0.3692 0.0609 0.0158

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

Analysis 1: Expression analysis during behavioral modification. Published in: Will et al., G3, 2020

Click here for more information

Orthologs

Orthofinder run ID4
Orthogroup4952
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|4935
Ophiocordyceps australis map64 (Brazil) OphauB2|948
Ophiocordyceps camponoti-floridani Ophcf2|01542 (this protein)
Ophiocordyceps camponoti-rufipedis Ophun1|6558
Ophiocordyceps kimflemingae Ophio5|4877
Ophiocordyceps subramaniannii Hirsu2|1910

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophcf2|01542
MQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRLRG
GMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRLR
GGMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRL
RGGMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLR
LRGGSEC*
Coding >Ophcf2|01542
ATGCAAATTTTCGTCAAGACTCTCACCGGCAAGACCATCACCCTCGAGGTGGAATCGTCCGACACCATCGACAAT
GTCAAGTCGAAGATTCAGGACAAGGAGGGCATCCCTCCTGATCAGCAGCGCCTGATTTTCGCTGGCAAGCAACTC
GAGGACGGTCGCACCCTGTCCGACTACAACATCCAGAAGGAGTCGACGCTCCACCTCGTCCTTCGCCTTCGTGGC
GGCATGCAGATTTTCGTCAAGACTCTGACTGGCAAGACCATCACCCTCGAGGTTGAGTCGTCCGACACCATCGAC
AACGTTAAGTCGAAGATTCAGGACAAGGAGGGCATCCCGCCTGACCAGCAACGCCTGATCTTCGCCGGCAAGCAG
CTTGAGGACGGCCGCACCCTCTCCGATTACAACATCCAGAAGGAGTCGACGCTTCACCTTGTCCTTCGTCTGCGC
GGTGGCATGCAAATCTTCGTCAAGACGCTCACTGGCAAAACGATCACCCTGGAAGTCGAGTCGTCGGACACGATC
GACAACGTCAAGTCAAAAATTCAGGATAAGGAGGGCATCCCGCCGGATCAGCAGCGTCTCATCTTTGCTGGCAAG
CAACTGGAAGATGGCCGGACACTGAGCGACTACAACATTCAGAAGGAGAGCACCCTGCACTTGGTGTTGCGCCTG
CGAGGAGGGATGCAGATTTTCGTCAAGACGTTGACGGGGAAGACGATTACGTTGGAGGTTGAATCTTCGGATACT
ATCGACAACGTCAAGTCGAAGATTCAGGACAAGGAAGGCATTCCTCCCGATCAGCAGCGTCTTATCTTCGCCGGC
AAGCAGTTGGAGGACGGCCGGACTCTTAGCGACTACAACATCCAGAAGGAGAGCACGCTTCATCTCGTGCTTCGG
CTCCGTGGAGGAAGCGAGTGCTGA
Transcript >Ophcf2|01542
ATGCAAATTTTCGTCAAGACTCTCACCGGCAAGACCATCACCCTCGAGGTGGAATCGTCCGACACCATCGACAAT
GTCAAGTCGAAGATTCAGGACAAGGAGGGCATCCCTCCTGATCAGCAGCGCCTGATTTTCGCTGGCAAGCAACTC
GAGGACGGTCGCACCCTGTCCGACTACAACATCCAGAAGGAGTCGACGCTCCACCTCGTCCTTCGCCTTCGTGGC
GGCATGCAGATTTTCGTCAAGACTCTGACTGGCAAGACCATCACCCTCGAGGTTGAGTCGTCCGACACCATCGAC
AACGTTAAGTCGAAGATTCAGGACAAGGAGGGCATCCCGCCTGACCAGCAACGCCTGATCTTCGCCGGCAAGCAG
CTTGAGGACGGCCGCACCCTCTCCGATTACAACATCCAGAAGGAGTCGACGCTTCACCTTGTCCTTCGTCTGCGC
GGTGGCATGCAAATCTTCGTCAAGACGCTCACTGGCAAAACGATCACCCTGGAAGTCGAGTCGTCGGACACGATC
GACAACGTCAAGTCAAAAATTCAGGATAAGGAGGGCATCCCGCCGGATCAGCAGCGTCTCATCTTTGCTGGCAAG
CAACTGGAAGATGGCCGGACACTGAGCGACTACAACATTCAGAAGGAGAGCACCCTGCACTTGGTGTTGCGCCTG
CGAGGAGGGATGCAGATTTTCGTCAAGACGTTGACGGGGAAGACGATTACGTTGGAGGTTGAATCTTCGGATACT
ATCGACAACGTCAAGTCGAAGATTCAGGACAAGGAAGGCATTCCTCCCGATCAGCAGCGTCTTATCTTCGCCGGC
AAGCAGTTGGAGGACGGCCGGACTCTTAGCGACTACAACATCCAGAAGGAGAGCACGCTTCATCTCGTGCTTCGG
CTCCGTGGAGGAAGCGAGTGCTGA
Gene >Ophcf2|01542
ATGCAAATTTTCGTCAAGACTCGTGAGTGCCTTGTCCTTCATCTCGTCGTCGTCATCGTGTGCTTCTGATGCTGA
CGTGGCGACAGTCACCGGCAAGACCATCACCCTCGAGGTGGAATCGTCCGACACCATCGACAATGTCAAGTCGAA
GATTCAGGACAAGGAGGGCATCCCTCCTGATCAGCAGCGCCTGATTTTCGCTGGCAAGCAACTCGAGGACGGTCG
CACCCTGTCCGACTACAACATCCAGAAGGAGTCGACGCTCCACCTCGTCCTTCGCCTTCGTGGCGGCATGCAGAT
TTGTGAGTTTTTGTTTTCCATTTACAAACGGCGGCGGCATACTTACTCTGATGATGTAGTCGTCAAGACTCTGAC
TGGCAAGACCATCACCCTCGAGGTTGAGTCGTCCGACACCATCGACAACGTTAAGTCGAAGATTCAGGACAAGGA
GGGCATCCCGCCTGACCAGCAACGCCTGATCTTCGCCGGCAAGCAGCTTGAGGACGGCCGCACCCTCTCCGATTA
CAACATCCAGAAGGAGTCGACGCTTCACCTTGTCCTTCGTCTGCGCGGTGGCATGCAAATCTTCGTCAAGACGCT
CACTGGCAAAACGATCACCCTGGAAGTCGAGTCGTCGGACACGATCGACAACGTCAAGTCAAAAATTCAGGATAA
GGAGGGCATCCCGCCGGATCAGCAGCGTCTCATCTTTGCTGGCAAGCAACTGGAAGATGGCCGGACACTGAGCGA
CTACAACATTCAGAAGGAGAGCACCCTGCACTTGGTGTTGCGCCTGCGAGGAGGGATGCAGATTTTCGTCAAGAC
GTTGACGGGGAAGACGATTACGTTGGAGGTTGAATCTTCGGATACTATCGACAACGTCAAGTCGAAGATTCAGGA
CAAGGAAGGCATTCCTCCCGATCAGCAGCGTCTTATCTTCGCCGGCAAGCAGTTGGAGGACGGCCGGACTCTTAG
CGACTACAACATCCAGAAGGAGAGCACGCTTCATCTCGTGCTTCGGCTCCGTGGAGGAAGCGAGTGCTGA

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail