Fungal Genomics

at Utrecht University

General Properties

Protein IDOphcf2|00139
Gene name
Locationscaffold_01:978292..978860
Strand-
Gene length (bp)568
Transcript length (bp)291
Coding sequence length (bp)291
Protein length (aa) 97

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF12734 CYSTM Cysteine-rich TM module stress tolerance 1.7E-05 43 85

GO

(None)

Deeploc

[Help with interpreting the results of Deeploc 2.0]
Localizations Signals Cytoplasm Nucleus Extracellular Cell membrane Mitochondrion Plastid Endoplasmic reticulum Lysosome vacuole Golgi apparatus Peroxisome
Cell membrane|Lysosome/Vacuole 0.419 0.2883 0.0597 0.6178 0.1049 0.0193 0.247 0.6536 0.3671 0.0557

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

Analysis 1: Expression analysis during behavioral modification. Published in: Will et al., G3, 2020

Click here for more information

Orthologs

Orthofinder run ID4
Orthogroup1560
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|5671
Ophiocordyceps australis map64 (Brazil) OphauB2|2406
Ophiocordyceps camponoti-floridani Ophcf2|00139 (this protein)
Ophiocordyceps camponoti-rufipedis Ophun1|3541
Ophiocordyceps kimflemingae Ophio5|3798
Ophiocordyceps subramaniannii Hirsu2|1140

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Ophcf2|00139
MSNQEYYGGGGGGYPQHPQPSYGPPQGNYGPPQGYNGGYQQGQPPMQYQQAPPQNDSRGRRGGSNNCLMACLAAL
CCCCVAEEGCECCLECCECLC*
Coding >Ophcf2|00139
ATGTCTAACCAGGAATACTATGGCGGCGGTGGTGGTGGCTATCCGCAGCACCCTCAACCCAGCTACGGTCCGCCG
CAGGGAAACTATGGCCCTCCTCAGGGATACAACGGCGGCTATCAACAAGGCCAGCCTCCAATGCAGTACCAACAG
GCCCCTCCTCAAAACGACTCCCGCGGCCGCCGCGGTGGAAGCAACAACTGTCTGATGGCATGTCTGGCCGCGCTT
TGCTGCTGCTGCGTCGCCGAAGAGGGCTGCGAATGCTGCCTCGAATGTTGCGAGTGCCTCTGTTAA
Transcript >Ophcf2|00139
ATGTCTAACCAGGAATACTATGGCGGCGGTGGTGGTGGCTATCCGCAGCACCCTCAACCCAGCTACGGTCCGCCG
CAGGGAAACTATGGCCCTCCTCAGGGATACAACGGCGGCTATCAACAAGGCCAGCCTCCAATGCAGTACCAACAG
GCCCCTCCTCAAAACGACTCCCGCGGCCGCCGCGGTGGAAGCAACAACTGTCTGATGGCATGTCTGGCCGCGCTT
TGCTGCTGCTGCGTCGCCGAAGAGGGCTGCGAATGCTGCCTCGAATGTTGCGAGTGCCTCTGTTAA
Gene >Ophcf2|00139
ATGTCTAACCAGGAATACTATGGCGGCGGTGGTGGTGGCTATCCGCAGCACCCTCAACCCGTAAGTCGCCTCGTC
TTCAAATGGTGATGCTATTGATGGGTCGACCATCTCCGTGCCAGGACCGTCGTCTTCTCCATGTCTCGCCATTAA
GCCATTCGAGCGACTGCCCTACTTGACCTATCACGAACAACGAGAAAAACATCATGACATGAGGACTCGCTTGCT
GACCCGGCCTTCCTCTCCACTATCTAGAGCTACGGTCCGCCGCAGGGAAACTATGGCCCTCCTCAGGGATACAAC
GGCGGCTATCAACAAGGCCAGCCTCCAATGCAGTACCAACAGGCCCCTCCTCAAAACGACTCCCGCGGCCGCCGC
GGTGGAAGCAACAACTGTCTGATGGCATGTCTGGCCGCGCTTTGCTGCTGCTGCGTCGCCGAAGAGGGCTGCGAA
TGCTGGTGCGTCTCGGACAGACACCACCACCTACACTTTCACTTCCCCGTGGCGGAAAGCTCTGTTGACTAACTT
CTTGTCCTCTCACAGCCTCGAATGTTGCGAGTGCCTCTGTTAA

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail