Fungal Genomics

at Utrecht University

General Properties

Protein IDOphauG2|974
Gene name
LocationContig_1260:749..1126
Strand-
Gene length (bp)377
Transcript length (bp)204
Coding sequence length (bp)204
Protein length (aa) 68

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF01200 Ribosomal_S28e Ribosomal protein S28e 1.6E-30 8 66

Swissprot hits

[Show all]
Swissprot ID Swissprot Description Start End E-value
sp|Q7S6W5|RS28_NEUCR 40S ribosomal protein S28 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=rps-28 PE=3 SV=1 3 67 1.0E-34
sp|P0CT80|RS28B_SCHPO 40S ribosomal protein S28-B OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=rps2802 PE=3 SV=1 3 67 1.0E-31
sp|P0CT79|RS28A_SCHPO 40S ribosomal protein S28-A OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=rps2801 PE=3 SV=1 3 67 1.0E-31
sp|Q74ZD8|RS28_ASHGO 40S ribosomal protein S28 OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) GN=RPS28A PE=3 SV=1 1 67 2.0E-30
sp|Q3E7X9|RS28A_YEAST 40S ribosomal protein S28-A OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS28A PE=1 SV=1 1 67 6.0E-30
[Show all]
[Show less]
Swissprot ID Swissprot Description Start End E-value
sp|Q7S6W5|RS28_NEUCR 40S ribosomal protein S28 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=rps-28 PE=3 SV=1 3 67 1.0E-34
sp|P0CT80|RS28B_SCHPO 40S ribosomal protein S28-B OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=rps2802 PE=3 SV=1 3 67 1.0E-31
sp|P0CT79|RS28A_SCHPO 40S ribosomal protein S28-A OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=rps2801 PE=3 SV=1 3 67 1.0E-31
sp|Q74ZD8|RS28_ASHGO 40S ribosomal protein S28 OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) GN=RPS28A PE=3 SV=1 1 67 2.0E-30
sp|Q3E7X9|RS28A_YEAST 40S ribosomal protein S28-A OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS28A PE=1 SV=1 1 67 6.0E-30
sp|P0C0X0|RS28B_YEAST 40S ribosomal protein S28-B OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS28B PE=1 SV=1 1 67 7.0E-30
sp|P33286|RS28_KLUMA 40S ribosomal protein S28 OS=Kluyveromyces marxianus GN=RPS28 PE=3 SV=1 1 67 7.0E-30
sp|P33285|RS28_KLULA 40S ribosomal protein S28 OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=RPS28 PE=1 SV=1 1 67 9.0E-30
sp|Q6FLC3|RS28_CANGA 40S ribosomal protein S28 OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) GN=RPS28A PE=3 SV=1 1 67 2.0E-29
sp|Q56JX6|RS28_BOVIN 40S ribosomal protein S28 OS=Bos taurus GN=RPS28 PE=3 SV=1 7 67 2.0E-27
sp|Q6PBK3|RS28_DANRE 40S ribosomal protein S28 OS=Danio rerio GN=rps28 PE=3 SV=1 7 67 2.0E-27
sp|P62857|RS28_HUMAN 40S ribosomal protein S28 OS=Homo sapiens GN=RPS28 PE=1 SV=1 7 67 2.0E-27
sp|P62858|RS28_MOUSE 40S ribosomal protein S28 OS=Mus musculus GN=Rps28 PE=1 SV=1 7 67 2.0E-27
sp|Q6QAT1|RS28_PIG 40S ribosomal protein S28 OS=Sus scrofa GN=RPS28 PE=1 SV=2 7 67 2.0E-27
sp|P62859|RS28_RAT 40S ribosomal protein S28 OS=Rattus norvegicus GN=Rps28 PE=1 SV=1 7 67 2.0E-27
sp|Q90YP3|RS28_ICTPU 40S ribosomal protein S28 OS=Ictalurus punctatus GN=rps28 PE=3 SV=1 7 67 2.0E-27
sp|P46302|RS28_MAIZE 40S ribosomal protein S28 OS=Zea mays GN=RPS28 PE=3 SV=1 7 67 4.0E-24
sp|Q95Y04|RS28_CAEEL 40S ribosomal protein S28 OS=Caenorhabditis elegans GN=rps-28 PE=3 SV=1 9 67 5.0E-24
sp|Q54MZ5|RS28_DICDI 40S ribosomal protein S28 OS=Dictyostelium discoideum GN=rps28 PE=3 SV=1 7 67 2.0E-23
sp|Q9W334|RS28_DROME 40S ribosomal protein S28 OS=Drosophila melanogaster GN=RpS28b PE=1 SV=2 7 67 9.0E-23
sp|O61590|RS28_OSTOS 40S ribosomal protein S28 OS=Ostertagia ostertagi GN=rps-28 PE=3 SV=1 7 67 8.0E-22
sp|Q962Q2|RS28_SPOFR 40S ribosomal protein S28 OS=Spodoptera frugiperda GN=RpS28 PE=3 SV=1 9 67 1.0E-21
sp|Q6EV21|RS28_PAPDA 40S ribosomal protein S28 OS=Papilio dardanus GN=RpS28 PE=3 SV=1 9 67 1.0E-21
sp|Q6PS50|RS28_BOMMO 40S ribosomal protein S28 OS=Bombyx mori GN=RpS28 PE=3 SV=1 9 67 1.0E-21
sp|Q9SR73|RS281_ARATH 40S ribosomal protein S28-1 OS=Arabidopsis thaliana GN=RPS28A PE=3 SV=1 7 67 7.0E-21
sp|P34789|RS282_ARATH 40S ribosomal protein S28-2 OS=Arabidopsis thaliana GN=RPS28C PE=3 SV=1 7 67 2.0E-20
sp|Q8TVE7|RS28_METKA 30S ribosomal protein S28e OS=Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938) GN=rps28e PE=3 SV=1 11 66 2.0E-12
sp|A4WLP1|RS28_PYRAR 30S ribosomal protein S28e OS=Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321) GN=rps28e PE=3 SV=1 12 66 2.0E-11
sp|B1Y9V2|RS28_PYRNV 30S ribosomal protein S28e OS=Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / V24Sta) GN=rps28e PE=3 SV=1 12 66 2.0E-11
sp|Q8ZTA7|RS28_PYRAE 30S ribosomal protein S28e OS=Pyrobaculum aerophilum (strain ATCC 51768 / IM2 / DSM 7523 / JCM 9630 / NBRC 100827) GN=rps28e PE=3 SV=1 12 66 2.0E-11
sp|A1RS33|RS28_PYRIL 30S ribosomal protein S28e OS=Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3) GN=rps28e PE=3 SV=1 12 66 2.0E-11
sp|Q975Z8|RS28_SULTO 30S ribosomal protein S28e OS=Sulfolobus tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7) GN=rps28e PE=3 SV=1 10 66 8.0E-11
sp|Q4JAV1|RS28_SULAC 30S ribosomal protein S28e OS=Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770) GN=rps28e PE=3 SV=1 10 66 9.0E-11
sp|P61030|RS28_PYRHO 30S ribosomal protein S28e OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) GN=rps28e PE=1 SV=1 11 67 1.0E-10
sp|P61029|RS28_PYRAB 30S ribosomal protein S28e OS=Pyrococcus abyssi (strain GE5 / Orsay) GN=rps28e PE=3 SV=1 11 67 1.0E-10
sp|Q8U159|RS28_PYRFU 30S ribosomal protein S28e OS=Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1) GN=rps28e PE=1 SV=1 11 67 1.0E-10
sp|Q9Y9A6|RS28_AERPE 30S ribosomal protein S28e OS=Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1) GN=rps28e PE=3 SV=3 11 66 2.0E-10
sp|Q980Q5|RS28_SULSO 30S ribosomal protein S28e OS=Sulfolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2) GN=rps28e PE=3 SV=2 11 66 2.0E-10
sp|P54065|RS28_METJA 30S ribosomal protein S28e OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) GN=rps28e PE=3 SV=2 11 66 2.0E-10
sp|A1RXH2|RS28_THEPD 30S ribosomal protein S28e OS=Thermofilum pendens (strain Hrk 5) GN=rps28e PE=3 SV=1 11 66 2.0E-10
sp|P61031|RS28_NANEQ 30S ribosomal protein S28e OS=Nanoarchaeum equitans (strain Kin4-M) GN=rps28e PE=3 SV=1 11 66 4.0E-10
sp|A4YCQ2|RS28_METS5 30S ribosomal protein S28e OS=Metallosphaera sedula (strain ATCC 51363 / DSM 5348) GN=rps28e PE=3 SV=1 11 66 7.0E-10
sp|Q97BK7|RS28_THEVO 30S ribosomal protein S28e OS=Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1) GN=rps28e PE=3 SV=1 11 66 1.0E-09
sp|B1L5N5|RS28_KORCO 30S ribosomal protein S28e OS=Korarchaeum cryptofilum (strain OPF8) GN=rps28e PE=3 SV=1 11 67 1.0E-09
sp|P57711|RS28_THEAC 30S ribosomal protein S28e OS=Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165) GN=rps28e PE=3 SV=1 11 66 2.0E-09
sp|O26356|RS28_METTH 30S ribosomal protein S28e OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H) GN=rps28e PE=1 SV=1 11 67 7.0E-09
sp|O29493|RS28_ARCFU 30S ribosomal protein S28e OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) GN=rps28e PE=3 SV=1 7 66 2.0E-08
sp|Q6KZI6|RS28_PICTO 30S ribosomal protein S28e OS=Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828) GN=rps28e PE=3 SV=1 11 66 2.0E-08
sp|A6USH4|RS28_METVS 30S ribosomal protein S28e OS=Methanococcus vannielii (strain SB / ATCC 35089 / DSM 1224) GN=rps28e PE=3 SV=1 11 66 1.0E-07
sp|Q8TQL8|RS28_METAC 30S ribosomal protein S28e OS=Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A) GN=rps28e PE=3 SV=1 11 66 1.0E-07
sp|Q8PU75|RS28_METMA 30S ribosomal protein S28e OS=Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88) GN=rps28e PE=3 SV=1 10 66 2.0E-07
sp|A6UT50|RS28_META3 30S ribosomal protein S28e OS=Methanococcus aeolicus (strain Nankai-3 / ATCC BAA-1280) GN=rps28e PE=3 SV=1 10 66 2.0E-07
sp|Q6LZI8|RS28_METMP 30S ribosomal protein S28e OS=Methanococcus maripaludis (strain S2 / LL) GN=rps28e PE=3 SV=1 10 66 2.0E-07
sp|A4FYI6|RS28_METM5 30S ribosomal protein S28e OS=Methanococcus maripaludis (strain C5 / ATCC BAA-1333) GN=rps28e PE=3 SV=1 10 66 3.0E-07
sp|Q5JGR4|RS28_THEKO 30S ribosomal protein S28e OS=Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1) GN=rps28e PE=3 SV=1 11 56 3.0E-07
sp|A6VJU6|RS28_METM7 30S ribosomal protein S28e OS=Methanococcus maripaludis (strain C7 / ATCC BAA-1331) GN=rps28e PE=3 SV=1 10 66 4.0E-07
sp|A9A7E6|RS28_METM6 30S ribosomal protein S28e OS=Methanococcus maripaludis (strain C6 / ATCC BAA-1332) GN=rps28e PE=3 SV=1 10 66 4.0E-07
sp|A2BK95|RS28_HYPBU 30S ribosomal protein S28e OS=Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5) GN=rps28e PE=3 SV=1 11 61 3.0E-06
sp|Q18GA9|RS28_HALWD 30S ribosomal protein S28e OS=Haloquadratum walsbyi (strain DSM 16790 / HBSQ001) GN=rps28e PE=3 SV=1 10 63 6.0E-06
[Show less]

GO

GO Term Description Terminal node
GO:0003735 structural constituent of ribosome Yes
GO:0005840 ribosome Yes
GO:0006412 translation Yes
GO:0008152 metabolic process No
GO:0043228 non-membrane-bounded organelle No
GO:0043603 cellular amide metabolic process No
GO:0043229 intracellular organelle No
GO:0009059 macromolecule biosynthetic process No
GO:1901576 organic substance biosynthetic process No
GO:0005198 structural molecule activity No
GO:0009058 biosynthetic process No
GO:0009987 cellular process No
GO:0008150 biological_process No
GO:1901566 organonitrogen compound biosynthetic process No
GO:0044238 primary metabolic process No
GO:0043226 organelle No
GO:0019538 protein metabolic process No
GO:0034645 cellular macromolecule biosynthetic process No
GO:0034641 cellular nitrogen compound metabolic process No
GO:0005575 cellular_component No
GO:0043170 macromolecule metabolic process No
GO:0006807 nitrogen compound metabolic process No
GO:0006518 peptide metabolic process No
GO:0071704 organic substance metabolic process No
GO:0043604 amide biosynthetic process No
GO:0044271 cellular nitrogen compound biosynthetic process No
GO:0044249 cellular biosynthetic process No
GO:0043232 intracellular non-membrane-bounded organelle No
GO:0003674 molecular_function No
GO:0110165 cellular anatomical entity No
GO:0044260 cellular macromolecule metabolic process No
GO:1901564 organonitrogen compound metabolic process No
GO:0044237 cellular metabolic process No
GO:0043043 peptide biosynthetic process No

Deeploc

Deeploc data not available for this genome

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup4962
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|974 (this protein)
Ophiocordyceps australis map64 (Brazil) OphauB2|7421
Ophiocordyceps camponoti-floridani Ophcf2|06194
Ophiocordyceps camponoti-rufipedis Ophun1|2228
Ophiocordyceps kimflemingae Ophio5|6426
Ophiocordyceps subramaniannii Hirsu2|1995

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >OphauG2|974
MDQKALVKLVKVTKVLGRTGSRGGVTQVRVEFMDDQTRSIIRNVKGPVREDDILCLLESEREARRLR*
Coding >OphauG2|974
ATGGATCAAAAAGCTCTCGTCAAGCTTGTCAAGGTGACCAAGGTGCTCGGCCGAACTGGTTCTCGCGGTGGTGTT
ACCCAGGTGCGCGTCGAGTTTATGGACGACCAGACTCGATCCATTATTCGCAACGTCAAGGGCCCTGTTCGCGAG
GACGACATTTTATGCTTACTCGAGTCGGAACGTGAAGCTAGACGGCTGCGATAG
Transcript >OphauG2|974
ATGGATCAAAAAGCTCTCGTCAAGCTTGTCAAGGTGACCAAGGTGCTCGGCCGAACTGGTTCTCGCGGTGGTGTT
ACCCAGGTGCGCGTCGAGTTTATGGACGACCAGACTCGATCCATTATTCGCAACGTCAAGGGCCCTGTTCGCGAG
GACGACATTTTATGCTTACTCGAGTCGGAACGTGAAGCTAGACGGCTGCGATAG
Gene >OphauG2|974
ATGGATCAAAAAGCTCTCGTCAAGCTTGTCAAGGTGACCAAGGTGCTCGGCCGAACTGGTACGCCATCGCCATTG
CCCTACCTTGTCAACAGACCAAAACCTGGGATTTTGTTGCGGCTTGGAAAGCATGGACTTGATTGCGAAACTAAC
AATTGATTAGGTTCTCGCGGTGGTGTTACCCAGGTGCGCGTCGAGTTTATGGACGACCAGACTCGATCCATTATT
CGCAACGTCAAGGGCCCTGGTATGCATGCATTCTTTGCGCATGGGATAAAGGGAAGCAGAACAAGGCAGATTCTG
ACAGATTTTTGTTAGTTCGCGAGGACGACATTTTATGCTTACTCGAGTCGGAACGTGAAGCTAGACGGCTGCGAT
AG

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail