Fungal Genomics

at Utrecht University

General Properties

Protein IDOphauG2|5671
Gene name
LocationContig_533:10099..10626
Strand-
Gene length (bp)527
Transcript length (bp)306
Coding sequence length (bp)306
Protein length (aa) 102

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF12734 CYSTM Cysteine-rich TM module stress tolerance 1.4E-05 48 90

Swissprot hits

(None)

GO

(None)

Deeploc

Deeploc data not available for this genome

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup1560
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|5671 (this protein)
Ophiocordyceps australis map64 (Brazil) OphauB2|2406
Ophiocordyceps camponoti-floridani Ophcf2|00139
Ophiocordyceps camponoti-rufipedis Ophun1|3541
Ophiocordyceps kimflemingae Ophio5|3798
Ophiocordyceps subramaniannii Hirsu2|1140

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >OphauG2|5671
MSNQDYYSGGQGGYHQGGYPQQPQPSYGQQTNYGPPQGPYDGGYHQGQPPMQYQQAPPPQNSRGNRGGSNNCLMA
CIAALCCCCVAEEGCECCMEFCECLF*
Coding >OphauG2|5671
ATGTCCAACCAGGACTACTACAGCGGCGGCCAGGGTGGCTACCACCAGGGCGGCTATCCCCAGCAGCCTCAGCCC
AGCTATGGCCAGCAAACCAACTACGGGCCTCCCCAGGGCCCCTATGACGGCGGCTACCATCAAGGCCAGCCGCCC
ATGCAATACCAGCAAGCTCCTCCCCCCCAAAACTCACGCGGAAACCGTGGCGGCAGCAACAATTGCCTAATGGCC
TGTATCGCTGCTCTTTGCTGTTGCTGTGTTGCCGAGGAAGGTTGCGAGTGTTGTATGGAATTCTGCGAATGCCTC
TTCTAG
Transcript >OphauG2|5671
ATGTCCAACCAGGACTACTACAGCGGCGGCCAGGGTGGCTACCACCAGGGCGGCTATCCCCAGCAGCCTCAGCCC
AGCTATGGCCAGCAAACCAACTACGGGCCTCCCCAGGGCCCCTATGACGGCGGCTACCATCAAGGCCAGCCGCCC
ATGCAATACCAGCAAGCTCCTCCCCCCCAAAACTCACGCGGAAACCGTGGCGGCAGCAACAATTGCCTAATGGCC
TGTATCGCTGCTCTTTGCTGTTGCTGTGTTGCCGAGGAAGGTTGCGAGTGTTGTATGGAATTCTGCGAATGCCTC
TTCTAG
Gene >OphauG2|5671
ATGTCCAACCAGGACTACTACAGCGGCGGCCAGGGTGGCTACCACCAGGGCGGCTATCCCCAGCAGCCTCAGCCC
GTAAGCTCCACCACAACTCCCTCTTTTTGCGGGGGGGGGGGGGTTTCCTTTGTCAAATCTAGCGCCTCCTGACTC
CATCTCGCTGCCCAAGTGCATCGTCGCTGCTTGGGCCAACATGCTGATGCCCCGACTTTGCATAATAGAGCTATG
GCCAGCAAACCAACTACGGGCCTCCCCAGGGCCCCTATGACGGCGGCTACCATCAAGGCCAGCCGCCCATGCAAT
ACCAGCAAGCTCCTCCCCCCCAAAACTCACGCGGAAACCGTGGCGGCAGCAACAATTGCCTAATGGCCTGTATCG
CTGCTCTTTGCTGTTGCTGTGTTGCCGAGGAAGGTTGCGAGTGTTGGTATGTCGTAAACTTGCTCTCATTTTCCC
TTTCCCCAAGCACCACATCAACAGCCATTGACACGCTTTTGTTCATTAGTATGGAATTCTGCGAATGCCTCTTCT
AG

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail