Fungal Genomics

at Utrecht University

General Properties

Protein IDOphauG2|332
Gene name
LocationContig_1072:321..558
Strand-
Gene length (bp)237
Transcript length (bp)237
Coding sequence length (bp)237
Protein length (aa) 79

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

Swissprot hits

(None)

GO

(None)

Deeploc

Deeploc data not available for this genome

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup4970
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|332 (this protein)
Ophiocordyceps australis map64 (Brazil) OphauB2|5313
Ophiocordyceps camponoti-floridani Ophcf2|02050
Ophiocordyceps camponoti-floridani Ophcf2|07439
Ophiocordyceps camponoti-rufipedis Ophun1|7012
Ophiocordyceps subramaniannii Hirsu2|2082

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >OphauG2|332
MDAPVSSPMQQRASSSTTSTMQAPTATTSAAAAAAAAXXXXXXXXXXPFLKDFTLVAEAAKRAQVAVLVRDLEGC
GLS*
Coding >OphauG2|332
ATGGACGCGCCCGTGTCTTCGCCCATGCAGCAGCGCGCCTCGTCATCGACGACTTCGACAATGCAGGCCCCGACT
GCTACTACTTCTGCTGCTGCTGCTGCGGCGGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTTTCTC
AAGGACTTTACGCTCGTGGCTGAGGCGGCCAAGCGGGCTCAGGTTGCGGTGCTGGTGCGGGATCTCGAGGGCTGT
GGGCTGTCGTAG
Transcript >OphauG2|332
ATGGACGCGCCCGTGTCTTCGCCCATGCAGCAGCGCGCCTCGTCATCGACGACTTCGACAATGCAGGCCCCGACT
GCTACTACTTCTGCTGCTGCTGCTGCGGCGGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTTTCTC
AAGGACTTTACGCTCGTGGCTGAGGCGGCCAAGCGGGCTCAGGTTGCGGTGCTGGTGCGGGATCTCGAGGGCTGT
GGGCTGTCGTAG
Gene >OphauG2|332
ATGGACGCGCCCGTGTCTTCGCCCATGCAGCAGCGCGCCTCGTCATCGACGACTTCGACAATGCAGGCCCCGACT
GCTACTACTTCTGCTGCTGCTGCTGCGGCGGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTTTCTC
AAGGACTTTACGCTCGTGGCTGAGGCGGCCAAGCGGGCTCAGGTTGCGGTGCTGGTGCGGGATCTCGAGGGCTGT
GGGCTGTCGTAG

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail