Fungal Genomics

at Utrecht University

General Properties

Protein IDOphauG2|2239
Gene name
LocationContig_1781:1718..2242
Strand+
Gene length (bp)524
Transcript length (bp)450
Coding sequence length (bp)450
Protein length (aa) 150

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF06220 zf-U1 U1 zinc finger 2.2E-07 9 42

Swissprot hits

Swissprot ID Swissprot Description Start End E-value
sp|O60138|YNS7_SCHPO Uncharacterized protein C18H10.07 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=SPBC18H10.07 PE=3 SV=1 1 51 6.0E-15
sp|Q61048|WBP4_MOUSE WW domain-binding protein 4 OS=Mus musculus GN=Wbp4 PE=1 SV=4 1 125 2.0E-07
sp|Q5HZF2|WBP4_RAT WW domain-binding protein 4 OS=Rattus norvegicus GN=Wbp4 PE=2 SV=1 1 65 2.0E-06
sp|O75554|WBP4_HUMAN WW domain-binding protein 4 OS=Homo sapiens GN=WBP4 PE=1 SV=1 1 65 6.0E-06

GO

GO Term Description Terminal node
GO:0008270 zinc ion binding Yes
GO:0003674 molecular_function No
GO:0046914 transition metal ion binding No
GO:0046872 metal ion binding No
GO:0043169 cation binding No
GO:0005488 binding No
GO:0043167 ion binding No

Deeploc

Deeploc data not available for this genome

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup5556
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|2239 (this protein)
Ophiocordyceps australis map64 (Brazil) OphauB2|1631
Ophiocordyceps camponoti-floridani Ophcf2|01293
Ophiocordyceps camponoti-rufipedis Ophun1|2647
Ophiocordyceps kimflemingae Ophio5|5543
Ophiocordyceps subramaniannii Hirsu2|7121

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >OphauG2|2239
MSEYWKSTPKYWCKHCSCYVRDTKLERQNHEATARHQGAIKRSLRELHRTHEREERDKERARREIARLNGVVSKD
GPNASNPAKSATRATSSETDLKRQRQQLADLGVAHGGGRGGNAQGRSCDGGAQATRRAETGGGGGRGGGDAATV*
Coding >OphauG2|2239
ATGTCTGAATACTGGAAGTCGACGCCCAAGTACTGGTGCAAGCATTGCTCGTGTTACGTGCGCGACACCAAGCTC
GAGCGACAAAACCACGAAGCCACAGCGCGCCACCAAGGCGCCATTAAACGCTCGCTACGAGAACTGCACCGCACA
CATGAACGCGAAGAGCGCGACAAGGAGCGAGCACGGCGAGAAATCGCGCGGCTCAATGGCGTCGTTTCCAAAGAC
GGGCCAAATGCGTCAAACCCAGCCAAGAGCGCAACAAGAGCGACGAGCAGCGAGACAGACCTCAAGAGGCAGCGG
CAGCAGCTGGCAGACCTGGGCGTTGCGCACGGGGGCGGACGGGGCGGAAACGCGCAAGGACGCAGTTGCGACGGG
GGTGCGCAAGCGACACGACGTGCAGAGACGGGAGGAGGAGGAGGAAGAGGAGGAGGCGATGCGGCGACTGTATAA
Transcript >OphauG2|2239
ATGTCTGAATACTGGAAGTCGACGCCCAAGTACTGGTGCAAGCATTGCTCGTGTTACGTGCGCGACACCAAGCTC
GAGCGACAAAACCACGAAGCCACAGCGCGCCACCAAGGCGCCATTAAACGCTCGCTACGAGAACTGCACCGCACA
CATGAACGCGAAGAGCGCGACAAGGAGCGAGCACGGCGAGAAATCGCGCGGCTCAATGGCGTCGTTTCCAAAGAC
GGGCCAAATGCGTCAAACCCAGCCAAGAGCGCAACAAGAGCGACGAGCAGCGAGACAGACCTCAAGAGGCAGCGG
CAGCAGCTGGCAGACCTGGGCGTTGCGCACGGGGGCGGACGGGGCGGAAACGCGCAAGGACGCAGTTGCGACGGG
GGTGCGCAAGCGACACGACGTGCAGAGACGGGAGGAGGAGGAGGAAGAGGAGGAGGCGATGCGGCGACTGTATAA
Gene >OphauG2|2239
ATGTCTGAATACTGGAAGTCGACGCCCAAGTACTGGTGCAAGCATTGCTCGTGTTACGTGCGCGACACCAAGCTC
GAGCGACAAAACCACGAAGCCACAGCGCGCCACCAAGGCGCCATTAAACGCTCGCTACGAGAACTGCACCGCACA
CATGAACGCGAAGAGCGCGACAAGGAGCGAGCACGGCGAGAAATCGCGCGGCTCAATGGCGTCGTTTCCAAAGAC
GGGCCAAATGCGTCAAACCCAGCCAAGAGCGCAACAAGAGCGACGAGCAGCGAGACAGACCTCAAGAGGCAGCGG
CAGCAGCTGGCAGACCTGGGCGTTGCGGTTCCGAGCACGTTTCGCGCGGAAATGGCCATGGCGGGAGACTGGACG
GTGACGCAGACGCGCGTGATTTCAAGCACGGGGGCGGACGGGGCGGAAACGCGCAAGGACGCAGTTGCGACGGGG
GTGCGCAAGCGACACGACGTGCAGAGACGGGAGGAGGAGGAGGAAGAGGAGGAGGCGATGCGGCGACTGTATAA

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail