Fungal Genomics

at Utrecht University

General Properties

Protein IDHirsu2|9317
Gene name
LocationContig_67:16..937
Strand-
Gene length (bp)921
Transcript length (bp)336
Coding sequence length (bp)336
Protein length (aa) 112

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

Swissprot hits

(None)

GO

(None)

Deeploc

[Help with interpreting the results of Deeploc 2.0]
Localizations Signals Cytoplasm Nucleus Extracellular Cell membrane Mitochondrion Plastid Endoplasmic reticulum Lysosome vacuole Golgi apparatus Peroxisome
Cytoplasm|Nucleus 0.5671 0.6255 0.4172 0.1035 0.1985 0.2758 0.1634 0.1169 0.1187 0.0821

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup6312
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|3627
Ophiocordyceps australis map64 (Brazil) OphauB2|128
Ophiocordyceps camponoti-rufipedis Ophun1|428
Ophiocordyceps kimflemingae Ophio5|5441
Ophiocordyceps subramaniannii Hirsu2|9317 (this protein)

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Hirsu2|9317
MPIANLVFLSPSLSLFRPSPSPKMSYAEVAASGPRQSPREASAPAPPEIIPNESASTASLIDVDLPSVHTVRSDF
LEQEVQTTTQAQRRDRESAAADAKDEIGRASCRERV*
Coding >Hirsu2|9317
ATGCCCATCGCCAATCTCGTTTTTCTCTCTCCCTCCCTCTCTCTCTTCCGCCCTTCGCCGTCTCCCAAGATGTCG
TACGCTGAGGTTGCCGCCAGTGGCCCCAGGCAATCTCCTCGGGAGGCCTCGGCACCGGCCCCTCCCGAGATCATC
CCCAACGAGAGCGCGTCGACGGCGTCGCTCATCGACGTCGACCTGCCCAGCGTGCACACGGTCCGGTCCGACTTC
CTGGAGCAGGAGGTGCAGACGACGACGCAGGCGCAGCGCCGCGACCGCGAGAGCGCCGCCGCCGACGCCAAGGAC
GAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAG
Transcript >Hirsu2|9317
ATGCCCATCGCCAATCTCGTTTTTCTCTCTCCCTCCCTCTCTCTCTTCCGCCCTTCGCCGTCTCCCAAGATGTCG
TACGCTGAGGTTGCCGCCAGTGGCCCCAGGCAATCTCCTCGGGAGGCCTCGGCACCGGCCCCTCCCGAGATCATC
CCCAACGAGAGCGCGTCGACGGCGTCGCTCATCGACGTCGACCTGCCCAGCGTGCACACGGTCCGGTCCGACTTC
CTGGAGCAGGAGGTGCAGACGACGACGCAGGCGCAGCGCCGCGACCGCGAGAGCGCCGCCGCCGACGCCAAGGAC
GAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAG
Gene >Hirsu2|9317
ATGCCCATCGCCAATCTCGTTTTGTTTGGTCTCCCATTCTCGTCGCCCTCCCCGGTCGCCGTTGCTCATGCGCCT
CGGCTCGCTGGCGCAGAATAACAACAGTCTGGCCGTACGTCATTGTTGTTCTTCCTGGCAGGGGCTGCGCGGTGT
GTAGGTAAGCAGGGCCGACCTACTCCTCTGGTAGTTGTTGCGTCACAAACGCCGCCCCTACAGAGACACGCCGAT
ACCACGCTGCTGCAGTGCCCCCTCTCGAGCGCAAATTCGATCGCCTCTCCTCCGCTCTCTCTCCCCCGTCCGCTT
CGCAGCTCGCGCTCCCACTCGCTCTCCGTCTTCCAGTCTCTCTCCCTCCCTCTCTCTCTTCCGCCCTTCGCCGTC
TCCCAAGAGTGAGCCTCCGCCCCCTTTCTGCGCCCTCGTGAGGAGGCCTGCTTTGCTGACCGCCGGGCGGTTTGG
CCGTTGCAGTGTCGTACGCTGAGGTTGCCGCCAGTGGCCCCAGGCAATCTCCTCGGGAGGTGAGTTCCGCTCCGC
AGCCTGCCAAAGAGGGGGGAGGTGGTGGTCGAGCAGAGGGACTCGTCGCGCGGCGGACAAGGGGGCGAAGCAGCC
GGCGAGGAACCAGCTTCCATGCAGAGAAGGGAGCGAAGAGAAGCAACAAAAAAAAAAGGGTGAGAGAGAGGAACA
GTCGGTCTCTGACAGTCGTCGCCGACGCAGGCCTCGGCACCGGCCCCTCCCGAGATCATCCCCAACGAGAGCGCG
TCGACGGCGTCGCTCATCGACGTCGACCTGCCCAGCGTGCACACGGTCCGGTCCGACTTCCTGGAGCAGGAGGTG
CAGACGACGACGCAGGCGCAGCGCCGCGACCGCGAGAGCGCCGCCGCCGACGCCAAGGACGAGATCGGAAGAGCG
TCGTGTAGGGAAAGAGTGTAG

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail