Fungal Genomics

at Utrecht University

General Properties

Protein IDHirsu2|1910
Gene name
LocationContig_1438:657..1723
Strand-
Gene length (bp)1066
Transcript length (bp)918
Coding sequence length (bp)918
Protein length (aa) 306

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF00240 ubiquitin Ubiquitin family 3.3E-33 3 74
PF00240 ubiquitin Ubiquitin family 3.3E-33 79 150
PF00240 ubiquitin Ubiquitin family 3.3E-33 155 226
PF00240 ubiquitin Ubiquitin family 3.3E-33 231 302
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 2.0E-15 1 71
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 2.0E-15 77 147
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 2.0E-15 153 223
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 2.0E-15 229 299
PF14560 Ubiquitin_2 Ubiquitin-like domain 4.8E-04 14 69
PF14560 Ubiquitin_2 Ubiquitin-like domain 4.3E-04 88 145
PF14560 Ubiquitin_2 Ubiquitin-like domain 4.3E-04 164 221
PF14560 Ubiquitin_2 Ubiquitin-like domain 4.3E-04 240 297
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.3E-01 15 71
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.2E-01 89 147
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.2E-01 165 223
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.3E-01 241 299

Swissprot hits

[Show all]
Swissprot ID Swissprot Description Start End E-value
sp|P0CG74|UBI4P_CANAX Polyubiquitin OS=Candida albicans GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG63|UBI4P_YEAST Polyubiquitin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG63|UBI4P_YEAST Polyubiquitin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=UBI4 PE=1 SV=1 1 304 0.0E+00
[Show all]
[Show less]
Swissprot ID Swissprot Description Start End E-value
sp|P0CG74|UBI4P_CANAX Polyubiquitin OS=Candida albicans GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG63|UBI4P_YEAST Polyubiquitin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG63|UBI4P_YEAST Polyubiquitin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG72|UBI4P_SCHPO Polyubiquitin OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG72|UBI4P_SCHPO Polyubiquitin OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P69309|UBIQP_AVEFA Polyubiquitin OS=Avena fatua PE=2 SV=2 1 305 0.0E+00
sp|Q3E7T8|UBQ14_ARATH Polyubiquitin 14 OS=Arabidopsis thaliana GN=UBQ14 PE=1 SV=2 1 304 0.0E+00
sp|P69325|UBIQP_SOYBN Polyubiquitin OS=Glycine max GN=SUBI-1 PE=2 SV=2 1 304 0.0E+00
sp|Q1EC66|UBQ3_ARATH Polyubiquitin 3 OS=Arabidopsis thaliana GN=UBQ3 PE=1 SV=1 1 304 0.0E+00
sp|P0CG70|UBI4P_NEUCR Polyubiquitin OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi PE=1 SV=1 1 305 0.0E+00
sp|P69322|UBIQP_PEA Polyubiquitin OS=Pisum sativum GN=PU1 PE=2 SV=2 1 304 0.0E+00
sp|P69322|UBIQP_PEA Polyubiquitin OS=Pisum sativum GN=PU1 PE=2 SV=2 1 304 0.0E+00
sp|P0CH32|UBQ4_ARATH Polyubiquitin 4 OS=Arabidopsis thaliana GN=UBQ4 PE=1 SV=1 1 304 0.0E+00
sp|P0CH32|UBQ4_ARATH Polyubiquitin 4 OS=Arabidopsis thaliana GN=UBQ4 PE=1 SV=1 1 304 0.0E+00
sp|Q58G87|UBQ3_ORYSJ Polyubiquitin 3 OS=Oryza sativa subsp. japonica GN=UBQ3 PE=2 SV=2 1 304 0.0E+00
sp|Q58G87|UBQ3_ORYSJ Polyubiquitin 3 OS=Oryza sativa subsp. japonica GN=UBQ3 PE=2 SV=2 1 304 0.0E+00
sp|P0CG84|UBI4P_NICSY Polyubiquitin (Fragment) OS=Nicotiana sylvestris GN=UBI4 PE=2 SV=1 1 304 0.0E+00
sp|P0CG84|UBI4P_NICSY Polyubiquitin (Fragment) OS=Nicotiana sylvestris GN=UBI4 PE=2 SV=1 5 304 0.0E+00
sp|Q8H159|UBQ10_ARATH Polyubiquitin 10 OS=Arabidopsis thaliana GN=UBQ10 PE=1 SV=2 1 304 0.0E+00
sp|Q8H159|UBQ10_ARATH Polyubiquitin 10 OS=Arabidopsis thaliana GN=UBQ10 PE=1 SV=2 1 304 0.0E+00
sp|Q8H159|UBQ10_ARATH Polyubiquitin 10 OS=Arabidopsis thaliana GN=UBQ10 PE=1 SV=2 1 304 0.0E+00
sp|P0CG85|UBI1P_NICSY Polyubiquitin OS=Nicotiana sylvestris GN=UBI11 PE=2 SV=1 1 304 0.0E+00
sp|P0CG85|UBI1P_NICSY Polyubiquitin OS=Nicotiana sylvestris GN=UBI11 PE=2 SV=1 1 304 0.0E+00
sp|P0CG85|UBI1P_NICSY Polyubiquitin OS=Nicotiana sylvestris GN=UBI11 PE=2 SV=1 1 304 0.0E+00
sp|P0CH05|UBI2P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-2 PE=3 SV=1 1 304 0.0E+00
sp|P0CH05|UBI2P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-2 PE=3 SV=1 1 304 0.0E+00
sp|P0CH05|UBI2P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-2 PE=3 SV=1 1 304 0.0E+00
sp|P0CH04|UBI1P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=2 SV=1 1 304 0.0E+00
sp|P0CH04|UBI1P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=2 SV=1 1 304 0.0E+00
sp|P0CH04|UBI1P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=2 SV=1 1 304 0.0E+00
sp|P0CH27|RL402_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi PE=2 SV=1 1 304 0.0E+00
sp|P0CG53|UBB_BOVIN Polyubiquitin-B OS=Bos taurus GN=UBB PE=1 SV=1 1 304 0.0E+00
sp|P42739|UBIQP_ACEPE Polyubiquitin (Fragment) OS=Acetabularia peniculus PE=3 SV=2 1 304 0.0E+00
sp|P42739|UBIQP_ACEPE Polyubiquitin (Fragment) OS=Acetabularia peniculus PE=3 SV=2 1 304 0.0E+00
sp|P42739|UBIQP_ACEPE Polyubiquitin (Fragment) OS=Acetabularia peniculus PE=3 SV=2 36 304 0.0E+00
sp|P0CG54|UBB_CAVPO Polyubiquitin-B OS=Cavia porcellus GN=UBB PE=2 SV=1 1 304 0.0E+00
sp|P0CG51|UBB_RAT Polyubiquitin-B OS=Rattus norvegicus GN=Ubb PE=1 SV=1 1 304 0.0E+00
sp|P0CG49|UBB_MOUSE Polyubiquitin-B OS=Mus musculus GN=Ubb PE=2 SV=1 1 304 0.0E+00
sp|P0CG62|UBB_CHICK Polyubiquitin-B OS=Gallus gallus GN=UBB PE=2 SV=1 1 304 0.0E+00
sp|P0CG55|UBB_SHEEP Polyubiquitin-B OS=Ovis aries GN=UBB PE=2 SV=1 1 304 0.0E+00
sp|P42740|UBIQP_AGLNE Polyubiquitin OS=Aglaothamnion neglectum PE=2 SV=2 1 304 0.0E+00
sp|P42740|UBIQP_AGLNE Polyubiquitin OS=Aglaothamnion neglectum PE=2 SV=2 1 304 0.0E+00
sp|P42740|UBIQP_AGLNE Polyubiquitin OS=Aglaothamnion neglectum PE=2 SV=2 1 304 0.0E+00
sp|Q8MKD1|UBB_HORSE Polyubiquitin-B OS=Equus caballus GN=UBB PE=2 SV=3 1 304 0.0E+00
sp|P59669|UBIQP_GEOCY Polyubiquitin OS=Geodia cydonium PE=2 SV=2 1 304 0.0E+00
sp|P59669|UBIQP_GEOCY Polyubiquitin OS=Geodia cydonium PE=2 SV=2 1 304 0.0E+00
sp|P59669|UBIQP_GEOCY Polyubiquitin OS=Geodia cydonium PE=2 SV=2 1 304 0.0E+00
sp|P0CG82|UBIQP_TETPY Polyubiquitin OS=Tetrahymena pyriformis GN=TU20 PE=3 SV=1 1 305 0.0E+00
sp|P0CG82|UBIQP_TETPY Polyubiquitin OS=Tetrahymena pyriformis GN=TU20 PE=3 SV=1 1 304 0.0E+00
sp|P0CG88|UBIQJ_DICDI Polyubiquitin-J OS=Dictyostelium discoideum GN=ubqJ PE=1 SV=1 1 304 0.0E+00
sp|P0CG80|UBIQI_DICDI Polyubiquitin-I OS=Dictyostelium discoideum GN=ubqI PE=1 SV=1 1 304 0.0E+00
sp|P0CG81|UBIQH_DICDI Polyubiquitin-H OS=Dictyostelium discoideum GN=ubqH PE=1 SV=1 1 304 0.0E+00
sp|P0CG81|UBIQH_DICDI Polyubiquitin-H OS=Dictyostelium discoideum GN=ubqH PE=1 SV=1 1 304 0.0E+00
sp|P0CG68|UBC_PIG Polyubiquitin-C OS=Sus scrofa GN=UBC PE=2 SV=1 1 304 0.0E+00
sp|P0CG68|UBC_PIG Polyubiquitin-C OS=Sus scrofa GN=UBC PE=2 SV=1 1 304 0.0E+00
sp|P0CG68|UBC_PIG Polyubiquitin-C OS=Sus scrofa GN=UBC PE=2 SV=1 1 304 0.0E+00
sp|P0CG68|UBC_PIG Polyubiquitin-C OS=Sus scrofa GN=UBC PE=2 SV=1 1 304 0.0E+00
sp|P0CG79|UBIQG_DICDI Polyubiquitin-G OS=Dictyostelium discoideum GN=ubqG PE=1 SV=1 1 304 0.0E+00
sp|P0CG79|UBIQG_DICDI Polyubiquitin-G OS=Dictyostelium discoideum GN=ubqG PE=1 SV=1 1 304 0.0E+00
sp|P0CG76|UBIQA_DICDI Polyubiquitin-A OS=Dictyostelium discoideum GN=ubqA PE=1 SV=1 1 304 0.0E+00
sp|P0CG76|UBIQA_DICDI Polyubiquitin-A OS=Dictyostelium discoideum GN=ubqA PE=1 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CG78|UBIQF_DICDI Polyubiquitin-F OS=Dictyostelium discoideum GN=ubqF PE=1 SV=1 1 304 0.0E+00
sp|P0CG78|UBIQF_DICDI Polyubiquitin-F OS=Dictyostelium discoideum GN=ubqF PE=1 SV=1 1 304 0.0E+00
sp|P0CG78|UBIQF_DICDI Polyubiquitin-F OS=Dictyostelium discoideum GN=ubqF PE=1 SV=1 1 304 0.0E+00
sp|P0CG78|UBIQF_DICDI Polyubiquitin-F OS=Dictyostelium discoideum GN=ubqF PE=1 SV=1 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q9FHQ6|UBQ9_ARATH Polyubiquitin 9 OS=Arabidopsis thaliana GN=UBQ9 PE=3 SV=1 1 305 0.0E+00
sp|P69315|UBIQP_LINUS Polyubiquitin (Fragment) OS=Linum usitatissimum PE=3 SV=2 36 304 0.0E+00
sp|P69315|UBIQP_LINUS Polyubiquitin (Fragment) OS=Linum usitatissimum PE=3 SV=2 1 264 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 260 9.0E-163
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 255 9.0E-161
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 255 7.0E-160
sp|P0CG73|UBI1P_CANAX Polyubiquitin OS=Candida albicans GN=UBI1 PE=1 SV=1 1 229 4.0E-158
sp|P0CG73|UBI1P_CANAX Polyubiquitin OS=Candida albicans GN=UBI1 PE=1 SV=1 77 304 5.0E-158
sp|P0CH33|UBQ11_ARATH Polyubiquitin 11 OS=Arabidopsis thaliana GN=UBQ11 PE=1 SV=1 1 229 2.0E-157
sp|P0CH33|UBQ11_ARATH Polyubiquitin 11 OS=Arabidopsis thaliana GN=UBQ11 PE=1 SV=1 77 304 3.0E-157
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 229 5.0E-157
sp|P0CG72|UBI4P_SCHPO Polyubiquitin OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi4 PE=1 SV=1 1 229 6.0E-157
sp|Q39256|UBQ8_ARATH Polyubiquitin 8 OS=Arabidopsis thaliana GN=UBQ8 PE=3 SV=1 1 304 8.0E-156
sp|Q58G87|UBQ3_ORYSJ Polyubiquitin 3 OS=Oryza sativa subsp. japonica GN=UBQ3 PE=2 SV=2 1 229 3.0E-155
sp|P0CG60|UBB_PONPY Polyubiquitin-B OS=Pongo pygmaeus GN=UBB PE=3 SV=1 1 229 4.0E-154
sp|P0CG60|UBB_PONPY Polyubiquitin-B OS=Pongo pygmaeus GN=UBB PE=3 SV=1 77 304 4.0E-154
sp|P0CG65|UBB_PANTR Polyubiquitin-B OS=Pan troglodytes GN=UBB PE=3 SV=1 1 229 4.0E-154
sp|P0CG65|UBB_PANTR Polyubiquitin-B OS=Pan troglodytes GN=UBB PE=3 SV=1 77 304 4.0E-154
sp|P0CG47|UBB_HUMAN Polyubiquitin-B OS=Homo sapiens GN=UBB PE=1 SV=1 1 229 4.0E-154
sp|P0CG47|UBB_HUMAN Polyubiquitin-B OS=Homo sapiens GN=UBB PE=1 SV=1 77 304 4.0E-154
sp|P0CG67|UBB_GORGO Polyubiquitin-B OS=Gorilla gorilla gorilla GN=UBB PE=3 SV=1 1 229 4.0E-154
sp|P0CG67|UBB_GORGO Polyubiquitin-B OS=Gorilla gorilla gorilla GN=UBB PE=3 SV=1 77 304 4.0E-154
sp|P0CH27|RL402_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi PE=2 SV=1 1 229 2.0E-153
sp|P42740|UBIQP_AGLNE Polyubiquitin OS=Aglaothamnion neglectum PE=2 SV=2 1 229 6.0E-153
sp|P0CG54|UBB_CAVPO Polyubiquitin-B OS=Cavia porcellus GN=UBB PE=2 SV=1 1 229 8.0E-153
sp|P23324|UBIQP_EUPEU Polyubiquitin OS=Euplotes eurystomus PE=3 SV=2 1 229 2.0E-152
sp|P23324|UBIQP_EUPEU Polyubiquitin OS=Euplotes eurystomus PE=3 SV=2 77 304 2.0E-152
sp|P0CG77|UBIQD_DICDI Polyubiquitin-D OS=Dictyostelium discoideum GN=ubqD PE=1 SV=1 1 229 2.0E-152
sp|P0CG77|UBIQD_DICDI Polyubiquitin-D OS=Dictyostelium discoideum GN=ubqD PE=1 SV=1 77 304 5.0E-152
sp|P22589|UBIQP_PHYIN Polyubiquitin OS=Phytophthora infestans PE=1 SV=2 1 228 7.0E-151
sp|P22589|UBIQP_PHYIN Polyubiquitin OS=Phytophthora infestans PE=1 SV=2 77 304 7.0E-151
sp|P0CG79|UBIQG_DICDI Polyubiquitin-G OS=Dictyostelium discoideum GN=ubqG PE=1 SV=1 1 229 8.0E-150
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 229 2.0E-148
sp|Q3E7K8|UBQ12_ARATH Polyubiquitin 12 OS=Arabidopsis thaliana GN=UBQ12 PE=3 SV=1 1 228 1.0E-147
sp|Q3E7K8|UBQ12_ARATH Polyubiquitin 12 OS=Arabidopsis thaliana GN=UBQ12 PE=3 SV=1 77 304 1.0E-147
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 229 2.0E-147
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 229 3.0E-147
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 230 3.0E-147
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 229 2.0E-146
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 229 2.0E-146
sp|Q39256|UBQ8_ARATH Polyubiquitin 8 OS=Arabidopsis thaliana GN=UBQ8 PE=3 SV=1 1 302 4.0E-136
sp|Q39256|UBQ8_ARATH Polyubiquitin 8 OS=Arabidopsis thaliana GN=UBQ8 PE=3 SV=1 1 304 2.0E-131
sp|P0CG83|UBIQP_HORVU Polyubiquitin (Fragment) OS=Hordeum vulgare PE=2 SV=1 135 305 8.0E-115
sp|P0CG83|UBIQP_HORVU Polyubiquitin (Fragment) OS=Hordeum vulgare PE=2 SV=1 59 228 1.0E-114
sp|P62972|UBIQP_XENLA Polyubiquitin (Fragment) OS=Xenopus laevis PE=1 SV=2 62 228 2.0E-109
sp|P62972|UBIQP_XENLA Polyubiquitin (Fragment) OS=Xenopus laevis PE=1 SV=2 138 304 2.0E-109
sp|P0CG83|UBIQP_HORVU Polyubiquitin (Fragment) OS=Hordeum vulgare PE=2 SV=1 1 152 2.0E-100
sp|P62972|UBIQP_XENLA Polyubiquitin (Fragment) OS=Xenopus laevis PE=1 SV=2 1 152 5.0E-98
sp|P23398|UBIQP_STRPU Polyubiquitin (Fragment) OS=Strongylocentrotus purpuratus PE=2 SV=2 173 305 1.0E-84
sp|P23398|UBIQP_STRPU Polyubiquitin (Fragment) OS=Strongylocentrotus purpuratus PE=2 SV=2 21 152 7.0E-84
sp|P23398|UBIQP_STRPU Polyubiquitin (Fragment) OS=Strongylocentrotus purpuratus PE=2 SV=2 97 228 7.0E-84
sp|P0C031|RUB2_ORYSJ Ubiquitin-NEDD8-like protein RUB2 OS=Oryza sativa subsp. japonica GN=RUB2 PE=2 SV=2 153 305 2.0E-80
sp|P0C073|RUB1_DESAN Ubiquitin-NEDD8-like protein RUB1 OS=Deschampsia antarctica GN=RUB1 PE=2 SV=2 1 152 5.0E-80
sp|P0C073|RUB1_DESAN Ubiquitin-NEDD8-like protein RUB1 OS=Deschampsia antarctica GN=RUB1 PE=2 SV=2 77 228 5.0E-80
sp|P0C073|RUB1_DESAN Ubiquitin-NEDD8-like protein RUB1 OS=Deschampsia antarctica GN=RUB1 PE=2 SV=2 153 304 5.0E-80
sp|Q9SHE7|RUB1_ARATH Ubiquitin-NEDD8-like protein RUB1 OS=Arabidopsis thaliana GN=RUB1 PE=1 SV=3 1 156 9.0E-80
sp|Q9SHE7|RUB1_ARATH Ubiquitin-NEDD8-like protein RUB1 OS=Arabidopsis thaliana GN=RUB1 PE=1 SV=3 77 232 9.0E-80
sp|P0C031|RUB2_ORYSJ Ubiquitin-NEDD8-like protein RUB2 OS=Oryza sativa subsp. japonica GN=RUB2 PE=2 SV=2 1 152 1.0E-79
sp|P0C031|RUB2_ORYSJ Ubiquitin-NEDD8-like protein RUB2 OS=Oryza sativa subsp. japonica GN=RUB2 PE=2 SV=2 77 228 1.0E-79
sp|Q9SHE7|RUB1_ARATH Ubiquitin-NEDD8-like protein RUB1 OS=Arabidopsis thaliana GN=RUB1 PE=1 SV=3 153 304 1.0E-79
sp|P0C030|RUB1_ORYSJ Ubiquitin-NEDD8-like protein RUB1 OS=Oryza sativa subsp. japonica GN=RUB1 PE=2 SV=2 1 152 1.0E-79
sp|P0C030|RUB1_ORYSJ Ubiquitin-NEDD8-like protein RUB1 OS=Oryza sativa subsp. japonica GN=RUB1 PE=2 SV=2 77 228 1.0E-79
sp|P0C030|RUB1_ORYSJ Ubiquitin-NEDD8-like protein RUB1 OS=Oryza sativa subsp. japonica GN=RUB1 PE=2 SV=2 153 304 1.0E-79
sp|Q8RUC6|RUB2_ARATH Ubiquitin-NEDD8-like protein RUB2 OS=Arabidopsis thaliana GN=RUB2 PE=1 SV=3 1 153 4.0E-79
sp|Q8RUC6|RUB2_ARATH Ubiquitin-NEDD8-like protein RUB2 OS=Arabidopsis thaliana GN=RUB2 PE=1 SV=3 77 229 4.0E-79
sp|Q8RUC6|RUB2_ARATH Ubiquitin-NEDD8-like protein RUB2 OS=Arabidopsis thaliana GN=RUB2 PE=1 SV=3 153 304 9.0E-79
sp|P0C032|RUB3_ORYSJ Ubiquitin-like protein-NEDD8-like protein RUB3 OS=Oryza sativa subsp. japonica GN=RUB3 PE=3 SV=2 1 152 4.0E-76
sp|P0C032|RUB3_ORYSJ Ubiquitin-like protein-NEDD8-like protein RUB3 OS=Oryza sativa subsp. japonica GN=RUB3 PE=3 SV=2 77 228 4.0E-76
sp|P0C032|RUB3_ORYSJ Ubiquitin-like protein-NEDD8-like protein RUB3 OS=Oryza sativa subsp. japonica GN=RUB3 PE=3 SV=2 153 304 4.0E-76
sp|P40909|RL40_CRYNJ Ubiquitin-60S ribosomal protein L40 OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=UBI1 PE=1 SV=2 1 77 1.0E-45
sp|P40909|RL40_CRYNJ Ubiquitin-60S ribosomal protein L40 OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=UBI1 PE=1 SV=2 77 153 1.0E-45
sp|P40909|RL40_CRYNJ Ubiquitin-60S ribosomal protein L40 OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=UBI1 PE=1 SV=2 153 229 1.0E-45
sp|P40909|RL40_CRYNJ Ubiquitin-60S ribosomal protein L40 OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=UBI1 PE=1 SV=2 229 304 2.0E-45
sp|P0CH07|RL402_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=uep1 PE=1 SV=1 1 77 2.0E-45
sp|P0CH07|RL402_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=uep1 PE=1 SV=1 77 153 2.0E-45
sp|P0CH07|RL402_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=uep1 PE=1 SV=1 153 229 2.0E-45
sp|P0CH07|RL402_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=uep1 PE=1 SV=1 229 304 2.0E-45
sp|P0CH06|RL401_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi1 PE=1 SV=1 1 77 2.0E-45
sp|P0CH06|RL401_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi1 PE=1 SV=1 77 153 2.0E-45
sp|P0CH06|RL401_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi1 PE=1 SV=1 153 229 2.0E-45
sp|P0CH06|RL401_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi1 PE=1 SV=1 229 304 2.0E-45
sp|P0CH09|RL402_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40B PE=1 SV=1 1 77 2.0E-45
sp|P0CH09|RL402_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40B PE=1 SV=1 77 153 2.0E-45
sp|P0CH09|RL402_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40B PE=1 SV=1 153 229 2.0E-45
sp|P0CH08|RL401_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40A PE=1 SV=1 1 77 2.0E-45
sp|P0CH08|RL401_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40A PE=1 SV=1 77 153 2.0E-45
sp|P0CH08|RL401_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40A PE=1 SV=1 153 229 2.0E-45
sp|P0CH09|RL402_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40B PE=1 SV=1 229 304 3.0E-45
sp|P0CH08|RL401_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40A PE=1 SV=1 229 304 3.0E-45
sp|P69326|UBIQ_WHEAT Ubiquitin OS=Triticum aestivum PE=3 SV=2 229 305 5.0E-45
sp|P51423|RL40_BRARP Ubiquitin-60S ribosomal protein L40 OS=Brassica rapa subsp. pekinensis PE=2 SV=2 1 77 6.0E-45
sp|P51423|RL40_BRARP Ubiquitin-60S ribosomal protein L40 OS=Brassica rapa subsp. pekinensis PE=2 SV=2 77 153 6.0E-45
sp|P51423|RL40_BRARP Ubiquitin-60S ribosomal protein L40 OS=Brassica rapa subsp. pekinensis PE=2 SV=2 153 229 6.0E-45
sp|P51423|RL40_BRARP Ubiquitin-60S ribosomal protein L40 OS=Brassica rapa subsp. pekinensis PE=2 SV=2 229 304 9.0E-45
sp|P49636|RL40_NICSY Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris GN=UBICEP52-7 PE=2 SV=2 1 77 9.0E-45
sp|P49636|RL40_NICSY Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris GN=UBICEP52-7 PE=2 SV=2 77 153 9.0E-45
sp|P49636|RL40_NICSY Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris GN=UBICEP52-7 PE=2 SV=2 153 229 9.0E-45
sp|P0CH35|RL40B_ORYSJ Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-2 PE=3 SV=1 1 77 9.0E-45
sp|P0CH35|RL40B_ORYSJ Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-2 PE=3 SV=1 77 153 9.0E-45
sp|P0CH35|RL40B_ORYSJ Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-2 PE=3 SV=1 153 229 9.0E-45
sp|P0CH34|RL40A_ORYSJ Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-1 PE=2 SV=1 1 77 9.0E-45
sp|P0CH34|RL40A_ORYSJ Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-1 PE=2 SV=1 77 153 9.0E-45
sp|P0CH34|RL40A_ORYSJ Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-1 PE=2 SV=1 153 229 9.0E-45
sp|P49636|RL40_NICSY Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris GN=UBICEP52-7 PE=2 SV=2 229 304 1.0E-44
sp|P0CH35|RL40B_ORYSJ Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-2 PE=3 SV=1 229 304 1.0E-44
sp|P0CH34|RL40A_ORYSJ Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-1 PE=2 SV=1 229 304 1.0E-44
sp|Q42202|RL40B_ARATH Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana GN=RPL40B PE=1 SV=2 1 77 1.0E-44
sp|Q42202|RL40B_ARATH Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana GN=RPL40B PE=1 SV=2 77 153 1.0E-44
sp|Q42202|RL40B_ARATH Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana GN=RPL40B PE=1 SV=2 153 229 1.0E-44
sp|B9DHA6|RL40A_ARATH Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana GN=RPL40A PE=1 SV=1 1 77 1.0E-44
sp|B9DHA6|RL40A_ARATH Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana GN=RPL40A PE=1 SV=1 77 153 1.0E-44
sp|B9DHA6|RL40A_ARATH Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana GN=RPL40A PE=1 SV=1 153 229 1.0E-44
sp|P0C224|RL40_NEUCR Ubiquitin-60S ribosomal protein L40 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=crp-79 PE=1 SV=2 1 77 1.0E-44
sp|P0C224|RL40_NEUCR Ubiquitin-60S ribosomal protein L40 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=crp-79 PE=1 SV=2 77 153 1.0E-44
sp|P0C224|RL40_NEUCR Ubiquitin-60S ribosomal protein L40 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=crp-79 PE=1 SV=2 153 229 1.0E-44
sp|P19848|UBIQ_COPCO Ubiquitin OS=Coprinellus congregatus PE=1 SV=1 1 76 1.0E-44
sp|P19848|UBIQ_COPCO Ubiquitin OS=Coprinellus congregatus PE=1 SV=1 77 152 1.0E-44
sp|P19848|UBIQ_COPCO Ubiquitin OS=Coprinellus congregatus PE=1 SV=1 153 228 1.0E-44
sp|P19848|UBIQ_COPCO Ubiquitin OS=Coprinellus congregatus PE=1 SV=1 229 304 1.0E-44
sp|Q42202|RL40B_ARATH Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana GN=RPL40B PE=1 SV=2 229 304 2.0E-44
sp|B9DHA6|RL40A_ARATH Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana GN=RPL40A PE=1 SV=1 229 304 2.0E-44
sp|P0C224|RL40_NEUCR Ubiquitin-60S ribosomal protein L40 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=crp-79 PE=1 SV=2 229 304 2.0E-44
sp|P69317|UBIQ_LUPPO Ubiquitin OS=Lupinus polyphyllus PE=3 SV=2 1 77 2.0E-44
sp|P69317|UBIQ_LUPPO Ubiquitin OS=Lupinus polyphyllus PE=3 SV=2 77 153 2.0E-44
sp|P69317|UBIQ_LUPPO Ubiquitin OS=Lupinus polyphyllus PE=3 SV=2 153 229 2.0E-44
sp|P69313|UBIQ_HELAN Ubiquitin OS=Helianthus annuus PE=3 SV=2 1 77 2.0E-44
sp|P69313|UBIQ_HELAN Ubiquitin OS=Helianthus annuus PE=3 SV=2 77 153 2.0E-44
sp|P69313|UBIQ_HELAN Ubiquitin OS=Helianthus annuus PE=3 SV=2 153 229 2.0E-44
sp|P69310|UBIQ_AVESA Ubiquitin OS=Avena sativa PE=1 SV=1 1 76 2.0E-44
sp|P69310|UBIQ_AVESA Ubiquitin OS=Avena sativa PE=1 SV=1 77 152 2.0E-44
sp|P69310|UBIQ_AVESA Ubiquitin OS=Avena sativa PE=1 SV=1 153 228 2.0E-44
sp|P69310|UBIQ_AVESA Ubiquitin OS=Avena sativa PE=1 SV=1 229 304 2.0E-44
sp|P69326|UBIQ_WHEAT Ubiquitin OS=Triticum aestivum PE=3 SV=2 1 76 3.0E-44
sp|P69326|UBIQ_WHEAT Ubiquitin OS=Triticum aestivum PE=3 SV=2 77 152 3.0E-44
sp|P69326|UBIQ_WHEAT Ubiquitin OS=Triticum aestivum PE=3 SV=2 153 228 3.0E-44
sp|P69317|UBIQ_LUPPO Ubiquitin OS=Lupinus polyphyllus PE=3 SV=2 229 304 3.0E-44
sp|P69313|UBIQ_HELAN Ubiquitin OS=Helianthus annuus PE=3 SV=2 229 304 3.0E-44
sp|P0CH10|RL403_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI3 PE=1 SV=1 1 77 3.0E-44
sp|P0CH10|RL403_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI3 PE=1 SV=1 77 153 3.0E-44
sp|P0CH10|RL403_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI3 PE=1 SV=1 153 229 3.0E-44
sp|P0CH11|RL401_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI1 PE=1 SV=1 1 77 3.0E-44
sp|P0CH11|RL401_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI1 PE=1 SV=1 77 153 3.0E-44
sp|P0CH11|RL401_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI1 PE=1 SV=1 153 229 3.0E-44
sp|P49632|RL40_CAEEL Ubiquitin-60S ribosomal protein L40 OS=Caenorhabditis elegans GN=ubq-2 PE=3 SV=2 1 77 3.0E-44
sp|P49632|RL40_CAEEL Ubiquitin-60S ribosomal protein L40 OS=Caenorhabditis elegans GN=ubq-2 PE=3 SV=2 77 153 3.0E-44
sp|P49632|RL40_CAEEL Ubiquitin-60S ribosomal protein L40 OS=Caenorhabditis elegans GN=ubq-2 PE=3 SV=2 153 229 3.0E-44
sp|P0CH10|RL403_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI3 PE=1 SV=1 229 304 4.0E-44
sp|P0CH11|RL401_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI1 PE=1 SV=1 229 304 4.0E-44
sp|P14795|RL40_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi GN=FUS1 PE=2 SV=2 1 77 4.0E-44
sp|P14795|RL40_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi GN=FUS1 PE=2 SV=2 77 153 4.0E-44
sp|P14795|RL40_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi GN=FUS1 PE=2 SV=2 153 229 4.0E-44
sp|Q9ARZ9|R27AA_ORYSJ Ubiquitin-40S ribosomal protein S27a-1 OS=Oryza sativa subsp. japonica GN=RPS27AA PE=2 SV=1 1 76 4.0E-44
sp|Q9ARZ9|R27AA_ORYSJ Ubiquitin-40S ribosomal protein S27a-1 OS=Oryza sativa subsp. japonica GN=RPS27AA PE=2 SV=1 77 152 4.0E-44
sp|Q9ARZ9|R27AA_ORYSJ Ubiquitin-40S ribosomal protein S27a-1 OS=Oryza sativa subsp. japonica GN=RPS27AA PE=2 SV=1 153 228 4.0E-44
sp|Q9ARZ9|R27AA_ORYSJ Ubiquitin-40S ribosomal protein S27a-1 OS=Oryza sativa subsp. japonica GN=RPS27AA PE=2 SV=1 229 304 4.0E-44
sp|P0CG86|RS271_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB1 PE=3 SV=1 1 76 4.0E-44
sp|P0CG86|RS271_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB1 PE=3 SV=1 77 152 4.0E-44
sp|P0CG86|RS271_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB1 PE=3 SV=1 153 228 4.0E-44
sp|P0CG86|RS271_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB1 PE=3 SV=1 229 304 4.0E-44
sp|P49632|RL40_CAEEL Ubiquitin-60S ribosomal protein L40 OS=Caenorhabditis elegans GN=ubq-2 PE=3 SV=2 229 304 5.0E-44
sp|P14795|RL40_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi GN=FUS1 PE=2 SV=2 229 304 5.0E-44
sp|P27923|RS27A_MAIZE Ubiquitin-40S ribosomal protein S27a OS=Zea mays GN=UBF9 PE=2 SV=2 1 76 5.0E-44
sp|P27923|RS27A_MAIZE Ubiquitin-40S ribosomal protein S27a OS=Zea mays GN=UBF9 PE=2 SV=2 77 152 5.0E-44
sp|P27923|RS27A_MAIZE Ubiquitin-40S ribosomal protein S27a OS=Zea mays GN=UBF9 PE=2 SV=2 153 228 5.0E-44
sp|P27923|RS27A_MAIZE Ubiquitin-40S ribosomal protein S27a OS=Zea mays GN=UBF9 PE=2 SV=2 229 304 5.0E-44
sp|P47905|RS27A_LUPAL Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus PE=3 SV=2 1 76 5.0E-44
sp|P47905|RS27A_LUPAL Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus PE=3 SV=2 77 152 5.0E-44
sp|P47905|RS27A_LUPAL Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus PE=3 SV=2 153 228 5.0E-44
sp|P47905|RS27A_LUPAL Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus PE=3 SV=2 229 304 5.0E-44
sp|P59233|R27AC_ARATH Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana GN=RPS27AC PE=1 SV=2 1 76 6.0E-44
sp|P59233|R27AC_ARATH Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana GN=RPS27AC PE=1 SV=2 77 152 6.0E-44
sp|P59233|R27AC_ARATH Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana GN=RPS27AC PE=1 SV=2 153 228 6.0E-44
sp|P59233|R27AC_ARATH Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana GN=RPS27AC PE=1 SV=2 229 304 6.0E-44
sp|P59232|R27AB_ARATH Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana GN=RPS27AB PE=1 SV=2 1 76 6.0E-44
sp|P59232|R27AB_ARATH Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana GN=RPS27AB PE=1 SV=2 77 152 6.0E-44
sp|P59232|R27AB_ARATH Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana GN=RPS27AB PE=1 SV=2 153 228 6.0E-44
sp|P59232|R27AB_ARATH Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana GN=RPS27AB PE=1 SV=2 229 304 6.0E-44
sp|P51431|R27AB_ORYSJ Ubiquitin-40S ribosomal protein S27a-2 OS=Oryza sativa subsp. japonica GN=RPS27AB PE=2 SV=3 1 76 6.0E-44
sp|P51431|R27AB_ORYSJ Ubiquitin-40S ribosomal protein S27a-2 OS=Oryza sativa subsp. japonica GN=RPS27AB PE=2 SV=3 77 152 6.0E-44
sp|P51431|R27AB_ORYSJ Ubiquitin-40S ribosomal protein S27a-2 OS=Oryza sativa subsp. japonica GN=RPS27AB PE=2 SV=3 153 228 6.0E-44
sp|P51431|R27AB_ORYSJ Ubiquitin-40S ribosomal protein S27a-2 OS=Oryza sativa subsp. japonica GN=RPS27AB PE=2 SV=3 229 304 6.0E-44
sp|P0CG87|RS272_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB2 PE=3 SV=1 1 76 6.0E-44
sp|P0CG87|RS272_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB2 PE=3 SV=1 77 152 6.0E-44
sp|P0CG87|RS272_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB2 PE=3 SV=1 153 228 6.0E-44
sp|P0CG87|RS272_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB2 PE=3 SV=1 229 304 6.0E-44
sp|P59271|R27AA_ARATH Ubiquitin-40S ribosomal protein S27a-1 OS=Arabidopsis thaliana GN=RPS27AA PE=1 SV=2 1 76 7.0E-44
sp|P59271|R27AA_ARATH Ubiquitin-40S ribosomal protein S27a-1 OS=Arabidopsis thaliana GN=RPS27AA PE=1 SV=2 77 152 7.0E-44
sp|P59271|R27AA_ARATH Ubiquitin-40S ribosomal protein S27a-1 OS=Arabidopsis thaliana GN=RPS27AA PE=1 SV=2 153 228 7.0E-44
sp|P59271|R27AA_ARATH Ubiquitin-40S ribosomal protein S27a-1 OS=Arabidopsis thaliana GN=RPS27AA PE=1 SV=2 229 304 7.0E-44
sp|P62981|RS27A_SOLTU Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum GN=UBI3 PE=2 SV=2 1 76 8.0E-44
sp|P62981|RS27A_SOLTU Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum GN=UBI3 PE=2 SV=2 77 152 8.0E-44
sp|P62981|RS27A_SOLTU Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum GN=UBI3 PE=2 SV=2 153 228 8.0E-44
sp|P62981|RS27A_SOLTU Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum GN=UBI3 PE=2 SV=2 229 304 8.0E-44
sp|P62980|RS27A_SOLLC Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum GN=UBI3 PE=3 SV=2 1 76 8.0E-44
sp|P62980|RS27A_SOLLC Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum GN=UBI3 PE=3 SV=2 77 152 8.0E-44
sp|P62980|RS27A_SOLLC Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum GN=UBI3 PE=3 SV=2 153 228 8.0E-44
sp|P62980|RS27A_SOLLC Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum GN=UBI3 PE=3 SV=2 229 304 8.0E-44
sp|P49633|RL40_ACACA Ubiquitin-60S ribosomal protein L40 OS=Acanthamoeba castellanii PE=2 SV=2 1 77 8.0E-44
sp|P49633|RL40_ACACA Ubiquitin-60S ribosomal protein L40 OS=Acanthamoeba castellanii PE=2 SV=2 77 153 8.0E-44
sp|P49633|RL40_ACACA Ubiquitin-60S ribosomal protein L40 OS=Acanthamoeba castellanii PE=2 SV=2 153 229 8.0E-44
sp|P0C276|RL40_SHEEP Ubiquitin-60S ribosomal protein L40 OS=Ovis aries GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P0C276|RL40_SHEEP Ubiquitin-60S ribosomal protein L40 OS=Ovis aries GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P0C276|RL40_SHEEP Ubiquitin-60S ribosomal protein L40 OS=Ovis aries GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P62986|RL40_RAT Ubiquitin-60S ribosomal protein L40 OS=Rattus norvegicus GN=Uba52 PE=1 SV=2 1 77 8.0E-44
sp|P62986|RL40_RAT Ubiquitin-60S ribosomal protein L40 OS=Rattus norvegicus GN=Uba52 PE=1 SV=2 77 153 8.0E-44
sp|P62986|RL40_RAT Ubiquitin-60S ribosomal protein L40 OS=Rattus norvegicus GN=Uba52 PE=1 SV=2 153 229 8.0E-44
sp|P0C275|RL40_PONPY Ubiquitin-60S ribosomal protein L40 OS=Pongo pygmaeus GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P0C275|RL40_PONPY Ubiquitin-60S ribosomal protein L40 OS=Pongo pygmaeus GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P0C275|RL40_PONPY Ubiquitin-60S ribosomal protein L40 OS=Pongo pygmaeus GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P63053|RL40_PIG Ubiquitin-60S ribosomal protein L40 OS=Sus scrofa GN=UBA52 PE=1 SV=2 1 77 8.0E-44
sp|P63053|RL40_PIG Ubiquitin-60S ribosomal protein L40 OS=Sus scrofa GN=UBA52 PE=1 SV=2 77 153 8.0E-44
sp|P63053|RL40_PIG Ubiquitin-60S ribosomal protein L40 OS=Sus scrofa GN=UBA52 PE=1 SV=2 153 229 8.0E-44
sp|P68205|RL40_OPHHA Ubiquitin-60S ribosomal protein L40 OS=Ophiophagus hannah PE=2 SV=2 1 77 8.0E-44
sp|P68205|RL40_OPHHA Ubiquitin-60S ribosomal protein L40 OS=Ophiophagus hannah PE=2 SV=2 77 153 8.0E-44
sp|P68205|RL40_OPHHA Ubiquitin-60S ribosomal protein L40 OS=Ophiophagus hannah PE=2 SV=2 153 229 8.0E-44
sp|P62984|RL40_MOUSE Ubiquitin-60S ribosomal protein L40 OS=Mus musculus GN=Uba52 PE=1 SV=2 1 77 8.0E-44
sp|P62984|RL40_MOUSE Ubiquitin-60S ribosomal protein L40 OS=Mus musculus GN=Uba52 PE=1 SV=2 77 153 8.0E-44
sp|P62984|RL40_MOUSE Ubiquitin-60S ribosomal protein L40 OS=Mus musculus GN=Uba52 PE=1 SV=2 153 229 8.0E-44
sp|P0C273|RL40_MACFA Ubiquitin-60S ribosomal protein L40 OS=Macaca fascicularis GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P0C273|RL40_MACFA Ubiquitin-60S ribosomal protein L40 OS=Macaca fascicularis GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P0C273|RL40_MACFA Ubiquitin-60S ribosomal protein L40 OS=Macaca fascicularis GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P62987|RL40_HUMAN Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 1 77 8.0E-44
sp|P62987|RL40_HUMAN Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 77 153 8.0E-44
sp|P62987|RL40_HUMAN Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 153 229 8.0E-44
sp|P63052|RL40_FELCA Ubiquitin-60S ribosomal protein L40 OS=Felis catus GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P63052|RL40_FELCA Ubiquitin-60S ribosomal protein L40 OS=Felis catus GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P63052|RL40_FELCA Ubiquitin-60S ribosomal protein L40 OS=Felis catus GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P63050|RL40_CANLF Ubiquitin-60S ribosomal protein L40 OS=Canis lupus familiaris GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P63050|RL40_CANLF Ubiquitin-60S ribosomal protein L40 OS=Canis lupus familiaris GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P63050|RL40_CANLF Ubiquitin-60S ribosomal protein L40 OS=Canis lupus familiaris GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P63048|RL40_BOVIN Ubiquitin-60S ribosomal protein L40 OS=Bos taurus GN=UBA52 PE=1 SV=2 1 77 8.0E-44
sp|P63048|RL40_BOVIN Ubiquitin-60S ribosomal protein L40 OS=Bos taurus GN=UBA52 PE=1 SV=2 77 153 8.0E-44
sp|P63048|RL40_BOVIN Ubiquitin-60S ribosomal protein L40 OS=Bos taurus GN=UBA52 PE=1 SV=2 153 229 8.0E-44
sp|P18101|RL40_DROME Ubiquitin-60S ribosomal protein L40 OS=Drosophila melanogaster GN=RpL40 PE=1 SV=2 1 77 9.0E-44
sp|P18101|RL40_DROME Ubiquitin-60S ribosomal protein L40 OS=Drosophila melanogaster GN=RpL40 PE=1 SV=2 77 153 9.0E-44
sp|P18101|RL40_DROME Ubiquitin-60S ribosomal protein L40 OS=Drosophila melanogaster GN=RpL40 PE=1 SV=2 153 229 9.0E-44
sp|P49633|RL40_ACACA Ubiquitin-60S ribosomal protein L40 OS=Acanthamoeba castellanii PE=2 SV=2 229 304 1.0E-43
sp|P0C276|RL40_SHEEP Ubiquitin-60S ribosomal protein L40 OS=Ovis aries GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P62986|RL40_RAT Ubiquitin-60S ribosomal protein L40 OS=Rattus norvegicus GN=Uba52 PE=1 SV=2 229 304 1.0E-43
sp|P0C275|RL40_PONPY Ubiquitin-60S ribosomal protein L40 OS=Pongo pygmaeus GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P63053|RL40_PIG Ubiquitin-60S ribosomal protein L40 OS=Sus scrofa GN=UBA52 PE=1 SV=2 229 304 1.0E-43
sp|P68205|RL40_OPHHA Ubiquitin-60S ribosomal protein L40 OS=Ophiophagus hannah PE=2 SV=2 229 304 1.0E-43
sp|P62984|RL40_MOUSE Ubiquitin-60S ribosomal protein L40 OS=Mus musculus GN=Uba52 PE=1 SV=2 229 304 1.0E-43
sp|P0C273|RL40_MACFA Ubiquitin-60S ribosomal protein L40 OS=Macaca fascicularis GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P62987|RL40_HUMAN Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 229 304 1.0E-43
sp|P63052|RL40_FELCA Ubiquitin-60S ribosomal protein L40 OS=Felis catus GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P63050|RL40_CANLF Ubiquitin-60S ribosomal protein L40 OS=Canis lupus familiaris GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P63048|RL40_BOVIN Ubiquitin-60S ribosomal protein L40 OS=Bos taurus GN=UBA52 PE=1 SV=2 229 304 1.0E-43
sp|P18101|RL40_DROME Ubiquitin-60S ribosomal protein L40 OS=Drosophila melanogaster GN=RpL40 PE=1 SV=2 229 304 1.0E-43
sp|P0DJ25|RL40_TETTS Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena thermophila (strain SB210) GN=RPL40 PE=1 SV=1 1 87 1.0E-43
sp|P0DJ25|RL40_TETTS Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena thermophila (strain SB210) GN=RPL40 PE=1 SV=1 77 163 1.0E-43
sp|P0DJ25|RL40_TETTS Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena thermophila (strain SB210) GN=RPL40 PE=1 SV=1 153 239 1.0E-43
sp|P33190|RL40_TETPY Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena pyriformis GN=TUF11 PE=3 SV=2 1 87 1.0E-43
sp|P33190|RL40_TETPY Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena pyriformis GN=TUF11 PE=3 SV=2 77 163 1.0E-43
sp|P33190|RL40_TETPY Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena pyriformis GN=TUF11 PE=3 SV=2 153 239 1.0E-43
sp|P0DJ25|RL40_TETTS Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena thermophila (strain SB210) GN=RPL40 PE=1 SV=1 229 304 2.0E-43
sp|P33190|RL40_TETPY Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena pyriformis GN=TUF11 PE=3 SV=2 229 304 2.0E-43
sp|P46575|RL40_EIMBO Ubiquitin-60S ribosomal protein L40 OS=Eimeria bovis PE=2 SV=2 1 77 3.0E-43
sp|P46575|RL40_EIMBO Ubiquitin-60S ribosomal protein L40 OS=Eimeria bovis PE=2 SV=2 77 153 3.0E-43
sp|P46575|RL40_EIMBO Ubiquitin-60S ribosomal protein L40 OS=Eimeria bovis PE=2 SV=2 153 229 3.0E-43
sp|P14794|RL40_DICDI Ubiquitin-60S ribosomal protein L40 OS=Dictyostelium discoideum GN=ubqB PE=1 SV=2 1 78 3.0E-43
sp|P14794|RL40_DICDI Ubiquitin-60S ribosomal protein L40 OS=Dictyostelium discoideum GN=ubqB PE=1 SV=2 77 154 3.0E-43
sp|P14794|RL40_DICDI Ubiquitin-60S ribosomal protein L40 OS=Dictyostelium discoideum GN=ubqB PE=1 SV=2 153 230 3.0E-43
sp|P62975|UBIQ_RABIT Ubiquitin OS=Oryctolagus cuniculus PE=1 SV=1 1 76 3.0E-43
sp|P62975|UBIQ_RABIT Ubiquitin OS=Oryctolagus cuniculus PE=1 SV=1 77 152 3.0E-43
sp|P62975|UBIQ_RABIT Ubiquitin OS=Oryctolagus cuniculus PE=1 SV=1 153 228 3.0E-43
sp|P62975|UBIQ_RABIT Ubiquitin OS=Oryctolagus cuniculus PE=1 SV=1 229 304 3.0E-43
sp|P68197|UBIQ_CERCA Ubiquitin OS=Ceratitis capitata PE=1 SV=1 1 76 3.0E-43
sp|P68197|UBIQ_CERCA Ubiquitin OS=Ceratitis capitata PE=1 SV=1 77 152 3.0E-43
sp|P68197|UBIQ_CERCA Ubiquitin OS=Ceratitis capitata PE=1 SV=1 153 228 3.0E-43
sp|P68197|UBIQ_CERCA Ubiquitin OS=Ceratitis capitata PE=1 SV=1 229 304 3.0E-43
sp|Q865C5|UBIQ_CAMDR Ubiquitin OS=Camelus dromedarius PE=3 SV=2 1 76 3.0E-43
sp|Q865C5|UBIQ_CAMDR Ubiquitin OS=Camelus dromedarius PE=3 SV=2 77 152 3.0E-43
sp|Q865C5|UBIQ_CAMDR Ubiquitin OS=Camelus dromedarius PE=3 SV=2 153 228 3.0E-43
sp|Q865C5|UBIQ_CAMDR Ubiquitin OS=Camelus dromedarius PE=3 SV=2 229 304 3.0E-43
sp|P46575|RL40_EIMBO Ubiquitin-60S ribosomal protein L40 OS=Eimeria bovis PE=2 SV=2 229 304 4.0E-43
sp|P69201|RL40_LEIMA Ubiquitin-60S ribosomal protein L40 OS=Leishmania major GN=UB-EP52 PE=3 SV=2 1 77 4.0E-43
sp|P69201|RL40_LEIMA Ubiquitin-60S ribosomal protein L40 OS=Leishmania major GN=UB-EP52 PE=3 SV=2 77 153 4.0E-43
sp|P69201|RL40_LEIMA Ubiquitin-60S ribosomal protein L40 OS=Leishmania major GN=UB-EP52 PE=3 SV=2 153 229 4.0E-43
sp|P21899|RL40_TRYBB Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma brucei brucei PE=1 SV=2 1 77 5.0E-43
sp|P21899|RL40_TRYBB Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma brucei brucei PE=1 SV=2 77 153 5.0E-43
sp|P21899|RL40_TRYBB Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma brucei brucei PE=1 SV=2 153 229 5.0E-43
sp|P79781|RS27A_CHICK Ubiquitin-40S ribosomal protein S27a OS=Gallus gallus GN=RPS27A PE=2 SV=3 1 76 5.0E-43
sp|P79781|RS27A_CHICK Ubiquitin-40S ribosomal protein S27a OS=Gallus gallus GN=RPS27A PE=2 SV=3 77 152 5.0E-43
sp|P79781|RS27A_CHICK Ubiquitin-40S ribosomal protein S27a OS=Gallus gallus GN=RPS27A PE=2 SV=3 153 228 5.0E-43
sp|P79781|RS27A_CHICK Ubiquitin-40S ribosomal protein S27a OS=Gallus gallus GN=RPS27A PE=2 SV=3 229 304 5.0E-43
sp|P69201|RL40_LEIMA Ubiquitin-60S ribosomal protein L40 OS=Leishmania major GN=UB-EP52 PE=3 SV=2 229 304 6.0E-43
sp|P21899|RL40_TRYBB Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma brucei brucei PE=1 SV=2 229 304 6.0E-43
sp|P62979|RS27A_HUMAN Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 1 76 6.0E-43
sp|P62979|RS27A_HUMAN Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 77 152 6.0E-43
sp|P62979|RS27A_HUMAN Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 153 228 6.0E-43
sp|P62979|RS27A_HUMAN Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 229 304 6.0E-43
sp|P62978|RS27A_CAVPO Ubiquitin-40S ribosomal protein S27a OS=Cavia porcellus GN=RPS27A PE=1 SV=2 1 76 6.0E-43
sp|P62978|RS27A_CAVPO Ubiquitin-40S ribosomal protein S27a OS=Cavia porcellus GN=RPS27A PE=1 SV=2 77 152 6.0E-43
sp|P62978|RS27A_CAVPO Ubiquitin-40S ribosomal protein S27a OS=Cavia porcellus GN=RPS27A PE=1 SV=2 153 228 6.0E-43
sp|P62978|RS27A_CAVPO Ubiquitin-40S ribosomal protein S27a OS=Cavia porcellus GN=RPS27A PE=1 SV=2 229 304 6.0E-43
sp|P62992|RS27A_BOVIN Ubiquitin-40S ribosomal protein S27a OS=Bos taurus GN=RPS27A PE=1 SV=2 1 76 6.0E-43
sp|P62992|RS27A_BOVIN Ubiquitin-40S ribosomal protein S27a OS=Bos taurus GN=RPS27A PE=1 SV=2 77 152 6.0E-43
sp|P62992|RS27A_BOVIN Ubiquitin-40S ribosomal protein S27a OS=Bos taurus GN=RPS27A PE=1 SV=2 153 228 6.0E-43
sp|P62992|RS27A_BOVIN Ubiquitin-40S ribosomal protein S27a OS=Bos taurus GN=RPS27A PE=1 SV=2 229 304 6.0E-43
sp|P68200|RS27A_ICTPU Ubiquitin-40S ribosomal protein S27a OS=Ictalurus punctatus GN=rps27a PE=2 SV=2 1 76 6.0E-43
sp|P68200|RS27A_ICTPU Ubiquitin-40S ribosomal protein S27a OS=Ictalurus punctatus GN=rps27a PE=2 SV=2 77 152 6.0E-43
sp|P68200|RS27A_ICTPU Ubiquitin-40S ribosomal protein S27a OS=Ictalurus punctatus GN=rps27a PE=2 SV=2 153 228 6.0E-43
sp|P68200|RS27A_ICTPU Ubiquitin-40S ribosomal protein S27a OS=Ictalurus punctatus GN=rps27a PE=2 SV=2 229 304 6.0E-43
sp|P14794|RL40_DICDI Ubiquitin-60S ribosomal protein L40 OS=Dictyostelium discoideum GN=ubqB PE=1 SV=2 229 304 7.0E-43
sp|P62982|RS27A_RAT Ubiquitin-40S ribosomal protein S27a OS=Rattus norvegicus GN=Rps27a PE=1 SV=2 1 76 7.0E-43
sp|P62982|RS27A_RAT Ubiquitin-40S ribosomal protein S27a OS=Rattus norvegicus GN=Rps27a PE=1 SV=2 77 152 7.0E-43
sp|P62982|RS27A_RAT Ubiquitin-40S ribosomal protein S27a OS=Rattus norvegicus GN=Rps27a PE=1 SV=2 153 228 7.0E-43
sp|P62982|RS27A_RAT Ubiquitin-40S ribosomal protein S27a OS=Rattus norvegicus GN=Rps27a PE=1 SV=2 229 304 7.0E-43
sp|P62983|RS27A_MOUSE Ubiquitin-40S ribosomal protein S27a OS=Mus musculus GN=Rps27a PE=1 SV=2 1 76 7.0E-43
sp|P62983|RS27A_MOUSE Ubiquitin-40S ribosomal protein S27a OS=Mus musculus GN=Rps27a PE=1 SV=2 77 152 7.0E-43
sp|P62983|RS27A_MOUSE Ubiquitin-40S ribosomal protein S27a OS=Mus musculus GN=Rps27a PE=1 SV=2 153 228 7.0E-43
sp|P62983|RS27A_MOUSE Ubiquitin-40S ribosomal protein S27a OS=Mus musculus GN=Rps27a PE=1 SV=2 229 304 7.0E-43
sp|P15357|RS27A_DROME Ubiquitin-40S ribosomal protein S27a OS=Drosophila melanogaster GN=RpS27A PE=1 SV=2 1 76 7.0E-43
sp|P15357|RS27A_DROME Ubiquitin-40S ribosomal protein S27a OS=Drosophila melanogaster GN=RpS27A PE=1 SV=2 77 152 7.0E-43
sp|P15357|RS27A_DROME Ubiquitin-40S ribosomal protein S27a OS=Drosophila melanogaster GN=RpS27A PE=1 SV=2 153 228 7.0E-43
sp|P15357|RS27A_DROME Ubiquitin-40S ribosomal protein S27a OS=Drosophila melanogaster GN=RpS27A PE=1 SV=2 229 304 7.0E-43
sp|Q8SWD4|UBIQ_ENCCU Ubiquitin OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU02_0740i PE=1 SV=1 1 76 9.0E-43
sp|Q8SWD4|UBIQ_ENCCU Ubiquitin OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU02_0740i PE=1 SV=1 77 152 9.0E-43
sp|Q8SWD4|UBIQ_ENCCU Ubiquitin OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU02_0740i PE=1 SV=1 153 228 9.0E-43
sp|Q8SWD4|UBIQ_ENCCU Ubiquitin OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU02_0740i PE=1 SV=1 229 304 9.0E-43
sp|P68202|RS27A_PLUXY Ubiquitin-40S ribosomal protein S27a OS=Plutella xylostella PE=2 SV=2 1 76 1.0E-42
sp|P68202|RS27A_PLUXY Ubiquitin-40S ribosomal protein S27a OS=Plutella xylostella PE=2 SV=2 77 152 1.0E-42
sp|P68202|RS27A_PLUXY Ubiquitin-40S ribosomal protein S27a OS=Plutella xylostella PE=2 SV=2 153 228 1.0E-42
sp|P68202|RS27A_PLUXY Ubiquitin-40S ribosomal protein S27a OS=Plutella xylostella PE=2 SV=2 229 304 1.0E-42
sp|P29504|RS27A_MANSE Ubiquitin-40S ribosomal protein S27a OS=Manduca sexta PE=2 SV=2 1 76 1.0E-42
sp|P29504|RS27A_MANSE Ubiquitin-40S ribosomal protein S27a OS=Manduca sexta PE=2 SV=2 77 152 1.0E-42
sp|P29504|RS27A_MANSE Ubiquitin-40S ribosomal protein S27a OS=Manduca sexta PE=2 SV=2 153 228 1.0E-42
sp|P29504|RS27A_MANSE Ubiquitin-40S ribosomal protein S27a OS=Manduca sexta PE=2 SV=2 229 304 1.0E-42
sp|P68203|RS27A_SPOFR Ubiquitin-40S ribosomal protein S27a OS=Spodoptera frugiperda PE=2 SV=2 1 76 1.0E-42
sp|P68203|RS27A_SPOFR Ubiquitin-40S ribosomal protein S27a OS=Spodoptera frugiperda PE=2 SV=2 77 152 1.0E-42
sp|P68203|RS27A_SPOFR Ubiquitin-40S ribosomal protein S27a OS=Spodoptera frugiperda PE=2 SV=2 153 228 1.0E-42
sp|P68203|RS27A_SPOFR Ubiquitin-40S ribosomal protein S27a OS=Spodoptera frugiperda PE=2 SV=2 229 304 1.0E-42
sp|P23398|UBIQP_STRPU Polyubiquitin (Fragment) OS=Strongylocentrotus purpuratus PE=2 SV=2 1 76 6.0E-42
sp|P59272|RS27A_DAUCA Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Daucus carota PE=2 SV=2 1 73 3.0E-41
sp|P59272|RS27A_DAUCA Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Daucus carota PE=2 SV=2 77 149 3.0E-41
sp|P59272|RS27A_DAUCA Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Daucus carota PE=2 SV=2 153 225 3.0E-41
sp|P59272|RS27A_DAUCA Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Daucus carota PE=2 SV=2 229 301 3.0E-41
sp|P69200|RL40_LEITA Ubiquitin-60S ribosomal protein L40 OS=Leishmania tarentolae GN=UB-EP52 PE=3 SV=2 1 77 6.0E-41
sp|P69200|RL40_LEITA Ubiquitin-60S ribosomal protein L40 OS=Leishmania tarentolae GN=UB-EP52 PE=3 SV=2 77 153 6.0E-41
sp|P69200|RL40_LEITA Ubiquitin-60S ribosomal protein L40 OS=Leishmania tarentolae GN=UB-EP52 PE=3 SV=2 153 229 6.0E-41
sp|P69200|RL40_LEITA Ubiquitin-60S ribosomal protein L40 OS=Leishmania tarentolae GN=UB-EP52 PE=3 SV=2 229 304 8.0E-41
sp|P0C8R3|RS27B_SCHPO Ubiquitin-40S ribosomal protein S27b OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi5 PE=1 SV=2 1 71 1.0E-40
sp|P0C8R3|RS27B_SCHPO Ubiquitin-40S ribosomal protein S27b OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi5 PE=1 SV=2 77 147 1.0E-40
sp|P0C8R3|RS27B_SCHPO Ubiquitin-40S ribosomal protein S27b OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi5 PE=1 SV=2 153 223 1.0E-40
sp|P0C8R3|RS27B_SCHPO Ubiquitin-40S ribosomal protein S27b OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi5 PE=1 SV=2 229 299 1.0E-40
sp|P0C016|RS27A_SCHPO Ubiquitin-40S ribosomal protein S27a OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi3 PE=1 SV=2 1 71 1.0E-40
sp|P0C016|RS27A_SCHPO Ubiquitin-40S ribosomal protein S27a OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi3 PE=1 SV=2 77 147 1.0E-40
sp|P0C016|RS27A_SCHPO Ubiquitin-40S ribosomal protein S27a OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi3 PE=1 SV=2 153 223 1.0E-40
sp|P0C016|RS27A_SCHPO Ubiquitin-40S ribosomal protein S27a OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi3 PE=1 SV=2 229 299 1.0E-40
sp|P14797|RS27A_DICDI Ubiquitin-40S ribosomal protein S27a OS=Dictyostelium discoideum GN=ubqC PE=1 SV=2 1 74 1.0E-40
sp|P14797|RS27A_DICDI Ubiquitin-40S ribosomal protein S27a OS=Dictyostelium discoideum GN=ubqC PE=1 SV=2 77 150 1.0E-40
sp|P14797|RS27A_DICDI Ubiquitin-40S ribosomal protein S27a OS=Dictyostelium discoideum GN=ubqC PE=1 SV=2 153 226 1.0E-40
sp|P14797|RS27A_DICDI Ubiquitin-40S ribosomal protein S27a OS=Dictyostelium discoideum GN=ubqC PE=1 SV=2 229 302 1.0E-40
sp|P05759|RS27A_YEAST Ubiquitin-40S ribosomal protein S31 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS31 PE=1 SV=3 1 70 3.0E-40
sp|P05759|RS27A_YEAST Ubiquitin-40S ribosomal protein S31 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS31 PE=1 SV=3 77 146 3.0E-40
sp|P05759|RS27A_YEAST Ubiquitin-40S ribosomal protein S31 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS31 PE=1 SV=3 153 222 3.0E-40
sp|P05759|RS27A_YEAST Ubiquitin-40S ribosomal protein S31 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS31 PE=1 SV=3 229 298 3.0E-40
sp|P69061|RS27A_KLULA Ubiquitin-40S ribosomal protein S27a OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi3 PE=1 SV=2 1 70 7.0E-40
sp|P69061|RS27A_KLULA Ubiquitin-40S ribosomal protein S27a OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi3 PE=1 SV=2 77 146 7.0E-40
sp|P69061|RS27A_KLULA Ubiquitin-40S ribosomal protein S27a OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi3 PE=1 SV=2 153 222 7.0E-40
sp|P69061|RS27A_KLULA Ubiquitin-40S ribosomal protein S27a OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi3 PE=1 SV=2 229 298 7.0E-40
sp|P14799|RS27A_NEUCR Ubiquitin-40S ribosomal protein S27a OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi::crp-6 PE=1 SV=4 1 70 3.0E-39
sp|P14799|RS27A_NEUCR Ubiquitin-40S ribosomal protein S27a OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi::crp-6 PE=1 SV=4 77 146 3.0E-39
sp|P14799|RS27A_NEUCR Ubiquitin-40S ribosomal protein S27a OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi::crp-6 PE=1 SV=4 153 222 3.0E-39
sp|P14799|RS27A_NEUCR Ubiquitin-40S ribosomal protein S27a OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi::crp-6 PE=1 SV=4 229 298 3.0E-39
sp|Q05120|UBIL_NPVOP Ubiquitin-like protein OS=Orgyia pseudotsugata multicapsid polyhedrosis virus GN=V-UBI PE=3 SV=1 1 76 2.0E-34
sp|Q05120|UBIL_NPVOP Ubiquitin-like protein OS=Orgyia pseudotsugata multicapsid polyhedrosis virus GN=V-UBI PE=3 SV=1 77 152 2.0E-34
sp|Q05120|UBIL_NPVOP Ubiquitin-like protein OS=Orgyia pseudotsugata multicapsid polyhedrosis virus GN=V-UBI PE=3 SV=1 153 228 2.0E-34
sp|Q05120|UBIL_NPVOP Ubiquitin-like protein OS=Orgyia pseudotsugata multicapsid polyhedrosis virus GN=V-UBI PE=3 SV=1 229 304 2.0E-34
sp|P16709|UBIL_NPVAC Ubiquitin-like protein OS=Autographa californica nuclear polyhedrosis virus GN=V-UBI PE=3 SV=2 1 76 5.0E-34
sp|P16709|UBIL_NPVAC Ubiquitin-like protein OS=Autographa californica nuclear polyhedrosis virus GN=V-UBI PE=3 SV=2 77 152 5.0E-34
sp|P16709|UBIL_NPVAC Ubiquitin-like protein OS=Autographa californica nuclear polyhedrosis virus GN=V-UBI PE=3 SV=2 153 228 5.0E-34
sp|P16709|UBIL_NPVAC Ubiquitin-like protein OS=Autographa californica nuclear polyhedrosis virus GN=V-UBI PE=3 SV=2 229 304 5.0E-34
sp|P84589|UBIQ_LUMTE Ubiquitin (Fragment) OS=Lumbricus terrestris PE=1 SV=2 12 74 1.0E-33
sp|P84589|UBIQ_LUMTE Ubiquitin (Fragment) OS=Lumbricus terrestris PE=1 SV=2 88 150 1.0E-33
sp|P84589|UBIQ_LUMTE Ubiquitin (Fragment) OS=Lumbricus terrestris PE=1 SV=2 164 226 1.0E-33
sp|P84589|UBIQ_LUMTE Ubiquitin (Fragment) OS=Lumbricus terrestris PE=1 SV=2 240 302 1.0E-33
sp|Q9VJ33|NEDD8_DROME NEDD8 OS=Drosophila melanogaster GN=Nedd8 PE=1 SV=1 1 84 6.0E-24
sp|Q9VJ33|NEDD8_DROME NEDD8 OS=Drosophila melanogaster GN=Nedd8 PE=1 SV=1 77 160 6.0E-24
sp|Q9VJ33|NEDD8_DROME NEDD8 OS=Drosophila melanogaster GN=Nedd8 PE=1 SV=1 153 236 6.0E-24
sp|Q9VJ33|NEDD8_DROME NEDD8 OS=Drosophila melanogaster GN=Nedd8 PE=1 SV=1 229 304 1.0E-23
sp|Q93725|NEDD8_CAEEL NEDD8 OS=Caenorhabditis elegans GN=ned-8 PE=1 SV=1 1 77 2.0E-23
sp|Q93725|NEDD8_CAEEL NEDD8 OS=Caenorhabditis elegans GN=ned-8 PE=1 SV=1 77 153 2.0E-23
sp|Q93725|NEDD8_CAEEL NEDD8 OS=Caenorhabditis elegans GN=ned-8 PE=1 SV=1 153 229 2.0E-23
sp|Q93725|NEDD8_CAEEL NEDD8 OS=Caenorhabditis elegans GN=ned-8 PE=1 SV=1 229 304 3.0E-23
sp|Q4PLJ0|NEDD8_RABIT NEDD8 OS=Oryctolagus cuniculus GN=NEDD8 PE=3 SV=1 1 76 8.0E-22
sp|Q4PLJ0|NEDD8_RABIT NEDD8 OS=Oryctolagus cuniculus GN=NEDD8 PE=3 SV=1 77 152 8.0E-22
sp|Q4PLJ0|NEDD8_RABIT NEDD8 OS=Oryctolagus cuniculus GN=NEDD8 PE=3 SV=1 153 228 8.0E-22
sp|Q4PLJ0|NEDD8_RABIT NEDD8 OS=Oryctolagus cuniculus GN=NEDD8 PE=3 SV=1 229 304 8.0E-22
sp|Q15843|NEDD8_HUMAN NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 1 76 8.0E-22
sp|Q15843|NEDD8_HUMAN NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 77 152 8.0E-22
sp|Q15843|NEDD8_HUMAN NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 153 228 8.0E-22
sp|Q15843|NEDD8_HUMAN NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 229 304 8.0E-22
sp|P61282|NEDD8_BOVIN NEDD8 OS=Bos taurus GN=NEDD8 PE=3 SV=1 1 76 8.0E-22
sp|P61282|NEDD8_BOVIN NEDD8 OS=Bos taurus GN=NEDD8 PE=3 SV=1 77 152 8.0E-22
sp|P61282|NEDD8_BOVIN NEDD8 OS=Bos taurus GN=NEDD8 PE=3 SV=1 153 228 8.0E-22
sp|P61282|NEDD8_BOVIN NEDD8 OS=Bos taurus GN=NEDD8 PE=3 SV=1 229 304 8.0E-22
sp|O65381|RUB3_ARATH NEDD8-like protein RUB3 OS=Arabidopsis thaliana GN=RUB3 PE=2 SV=1 1 77 2.0E-21
sp|O65381|RUB3_ARATH NEDD8-like protein RUB3 OS=Arabidopsis thaliana GN=RUB3 PE=2 SV=1 77 153 2.0E-21
sp|O65381|RUB3_ARATH NEDD8-like protein RUB3 OS=Arabidopsis thaliana GN=RUB3 PE=2 SV=1 153 229 2.0E-21
sp|Q54XV3|NEDD8_DICDI NEDD8 OS=Dictyostelium discoideum GN=nedd8 PE=3 SV=2 1 77 2.0E-21
sp|Q54XV3|NEDD8_DICDI NEDD8 OS=Dictyostelium discoideum GN=nedd8 PE=3 SV=2 77 153 2.0E-21
sp|Q54XV3|NEDD8_DICDI NEDD8 OS=Dictyostelium discoideum GN=nedd8 PE=3 SV=2 153 229 2.0E-21
sp|O65381|RUB3_ARATH NEDD8-like protein RUB3 OS=Arabidopsis thaliana GN=RUB3 PE=2 SV=1 229 304 3.0E-21
sp|Q54XV3|NEDD8_DICDI NEDD8 OS=Dictyostelium discoideum GN=nedd8 PE=3 SV=2 229 304 5.0E-21
sp|O14399|UBL1_SCHPO Ubiquitin-like protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubl1 PE=3 SV=1 1 76 7.0E-21
sp|O14399|UBL1_SCHPO Ubiquitin-like protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubl1 PE=3 SV=1 77 152 7.0E-21
sp|O14399|UBL1_SCHPO Ubiquitin-like protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubl1 PE=3 SV=1 153 228 7.0E-21
sp|O14399|UBL1_SCHPO Ubiquitin-like protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubl1 PE=3 SV=1 229 304 7.0E-21
sp|P31753|RS27A_ASPOF Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Asparagus officinalis PE=2 SV=2 37 76 2.0E-19
sp|P31753|RS27A_ASPOF Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Asparagus officinalis PE=2 SV=2 113 152 2.0E-19
sp|P31753|RS27A_ASPOF Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Asparagus officinalis PE=2 SV=2 189 228 2.0E-19
sp|P31753|RS27A_ASPOF Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Asparagus officinalis PE=2 SV=2 265 304 2.0E-19
sp|Q03919|RUB1_YEAST NEDD8-like protein RUB1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RUB1 PE=1 SV=1 1 76 1.0E-18
sp|Q03919|RUB1_YEAST NEDD8-like protein RUB1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RUB1 PE=1 SV=1 77 152 1.0E-18
sp|Q03919|RUB1_YEAST NEDD8-like protein RUB1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RUB1 PE=1 SV=1 153 228 1.0E-18
sp|Q03919|RUB1_YEAST NEDD8-like protein RUB1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RUB1 PE=1 SV=1 229 304 1.0E-18
sp|Q9ZPY9|P4KG4_ARATH Phosphatidylinositol 4-kinase gamma 4 OS=Arabidopsis thaliana GN=PI4KG4 PE=1 SV=1 7 148 5.0E-18
sp|Q9ZPY9|P4KG4_ARATH Phosphatidylinositol 4-kinase gamma 4 OS=Arabidopsis thaliana GN=PI4KG4 PE=1 SV=1 159 300 5.0E-18
sp|Q64339|ISG15_MOUSE Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15 PE=1 SV=4 5 152 2.0E-17
sp|Q64339|ISG15_MOUSE Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15 PE=1 SV=4 81 228 2.0E-17
sp|Q64339|ISG15_MOUSE Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15 PE=1 SV=4 157 304 2.0E-17
sp|Q71UE8|NEDD8_RAT NEDD8 OS=Rattus norvegicus GN=Nedd8 PE=1 SV=1 1 68 4.0E-17
sp|Q71UE8|NEDD8_RAT NEDD8 OS=Rattus norvegicus GN=Nedd8 PE=1 SV=1 77 144 4.0E-17
sp|Q71UE8|NEDD8_RAT NEDD8 OS=Rattus norvegicus GN=Nedd8 PE=1 SV=1 153 220 4.0E-17
sp|Q71UE8|NEDD8_RAT NEDD8 OS=Rattus norvegicus GN=Nedd8 PE=1 SV=1 229 296 4.0E-17
sp|P29595|NEDD8_MOUSE NEDD8 OS=Mus musculus GN=Nedd8 PE=1 SV=2 1 68 4.0E-17
sp|P29595|NEDD8_MOUSE NEDD8 OS=Mus musculus GN=Nedd8 PE=1 SV=2 77 144 4.0E-17
sp|P29595|NEDD8_MOUSE NEDD8 OS=Mus musculus GN=Nedd8 PE=1 SV=2 153 220 4.0E-17
sp|P29595|NEDD8_MOUSE NEDD8 OS=Mus musculus GN=Nedd8 PE=1 SV=2 229 296 4.0E-17
sp|O15205|UBD_HUMAN Ubiquitin D OS=Homo sapiens GN=UBD PE=1 SV=2 1 152 3.0E-16
sp|O15205|UBD_HUMAN Ubiquitin D OS=Homo sapiens GN=UBD PE=1 SV=2 77 228 3.0E-16
sp|O15205|UBD_HUMAN Ubiquitin D OS=Homo sapiens GN=UBD PE=1 SV=2 153 304 3.0E-16
sp|D3Z3C6|ZFAN4_MOUSE AN1-type zinc finger protein 4 OS=Mus musculus GN=Zfand4 PE=3 SV=2 59 152 1.0E-13
sp|D3Z3C6|ZFAN4_MOUSE AN1-type zinc finger protein 4 OS=Mus musculus GN=Zfand4 PE=3 SV=2 135 228 1.0E-13
sp|D3Z3C6|ZFAN4_MOUSE AN1-type zinc finger protein 4 OS=Mus musculus GN=Zfand4 PE=3 SV=2 211 304 1.0E-13
sp|D3Z3C6|ZFAN4_MOUSE AN1-type zinc finger protein 4 OS=Mus musculus GN=Zfand4 PE=3 SV=2 1 76 2.0E-13
sp|Q921A3|UBD_RAT Ubiquitin D OS=Rattus norvegicus GN=Ubd PE=1 SV=1 3 152 3.0E-13
sp|Q921A3|UBD_RAT Ubiquitin D OS=Rattus norvegicus GN=Ubd PE=1 SV=1 79 228 3.0E-13
sp|Q921A3|UBD_RAT Ubiquitin D OS=Rattus norvegicus GN=Ubd PE=1 SV=1 155 304 3.0E-13
sp|Q9SGW8|P4KG2_ARATH Phosphatidylinositol 4-kinase gamma 2 OS=Arabidopsis thaliana GN=PI4KG2 PE=1 SV=2 7 148 9.0E-13
sp|Q9SGW8|P4KG2_ARATH Phosphatidylinositol 4-kinase gamma 2 OS=Arabidopsis thaliana GN=PI4KG2 PE=1 SV=2 83 224 9.0E-13
sp|Q9SGW8|P4KG2_ARATH Phosphatidylinositol 4-kinase gamma 2 OS=Arabidopsis thaliana GN=PI4KG2 PE=1 SV=2 159 300 9.0E-13
sp|Q86XD8|ZFAN4_HUMAN AN1-type zinc finger protein 4 OS=Homo sapiens GN=ZFAND4 PE=2 SV=2 59 152 1.0E-12
sp|Q86XD8|ZFAN4_HUMAN AN1-type zinc finger protein 4 OS=Homo sapiens GN=ZFAND4 PE=2 SV=2 135 228 1.0E-12
sp|Q86XD8|ZFAN4_HUMAN AN1-type zinc finger protein 4 OS=Homo sapiens GN=ZFAND4 PE=2 SV=2 211 304 1.0E-12
sp|Q86XD8|ZFAN4_HUMAN AN1-type zinc finger protein 4 OS=Homo sapiens GN=ZFAND4 PE=2 SV=2 1 76 1.0E-12
sp|Q9FNF8|P4KG3_ARATH Phosphatidylinositol 4-kinase gamma 3 OS=Arabidopsis thaliana GN=PI4KG3 PE=2 SV=1 7 147 1.0E-12
sp|Q9FNF8|P4KG3_ARATH Phosphatidylinositol 4-kinase gamma 3 OS=Arabidopsis thaliana GN=PI4KG3 PE=2 SV=1 83 223 1.0E-12
sp|Q9FNF8|P4KG3_ARATH Phosphatidylinositol 4-kinase gamma 3 OS=Arabidopsis thaliana GN=PI4KG3 PE=2 SV=1 159 299 1.0E-12
sp|O02741|ISG15_BOVIN Ubiquitin-like protein ISG15 OS=Bos taurus GN=ISG15 PE=2 SV=3 5 152 1.0E-12
sp|O02741|ISG15_BOVIN Ubiquitin-like protein ISG15 OS=Bos taurus GN=ISG15 PE=2 SV=3 81 228 1.0E-12
sp|O02741|ISG15_BOVIN Ubiquitin-like protein ISG15 OS=Bos taurus GN=ISG15 PE=2 SV=3 157 304 1.0E-12
sp|P37164|RS27A_CAEBR Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis briggsae GN=ubl-1 PE=1 SV=2 3 78 3.0E-12
sp|P37164|RS27A_CAEBR Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis briggsae GN=ubl-1 PE=1 SV=2 79 154 3.0E-12
sp|P37164|RS27A_CAEBR Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis briggsae GN=ubl-1 PE=1 SV=2 155 230 3.0E-12
sp|P37164|RS27A_CAEBR Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis briggsae GN=ubl-1 PE=1 SV=2 231 304 4.0E-12
sp|P37165|RS27A_CAEEL Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis elegans GN=ubl-1 PE=1 SV=2 3 78 6.0E-12
sp|P37165|RS27A_CAEEL Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis elegans GN=ubl-1 PE=1 SV=2 79 154 6.0E-12
sp|P37165|RS27A_CAEEL Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis elegans GN=ubl-1 PE=1 SV=2 155 230 6.0E-12
sp|P63072|UBD_MOUSE Ubiquitin D OS=Mus musculus GN=Ubd PE=1 SV=1 3 152 6.0E-12
sp|P63072|UBD_MOUSE Ubiquitin D OS=Mus musculus GN=Ubd PE=1 SV=1 79 228 6.0E-12
sp|P63072|UBD_MOUSE Ubiquitin D OS=Mus musculus GN=Ubd PE=1 SV=1 155 304 6.0E-12
sp|P37165|RS27A_CAEEL Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis elegans GN=ubl-1 PE=1 SV=2 231 304 7.0E-12
sp|P05161|ISG15_HUMAN Ubiquitin-like protein ISG15 OS=Homo sapiens GN=ISG15 PE=1 SV=5 76 228 8.0E-12
sp|P05161|ISG15_HUMAN Ubiquitin-like protein ISG15 OS=Homo sapiens GN=ISG15 PE=1 SV=5 152 304 8.0E-12
sp|P05161|ISG15_HUMAN Ubiquitin-like protein ISG15 OS=Homo sapiens GN=ISG15 PE=1 SV=5 5 152 3.0E-11
sp|B2GV38|UBL4A_RAT Ubiquitin-like protein 4A OS=Rattus norvegicus GN=Ubl4a PE=2 SV=1 1 72 5.0E-11
sp|B2GV38|UBL4A_RAT Ubiquitin-like protein 4A OS=Rattus norvegicus GN=Ubl4a PE=2 SV=1 77 148 5.0E-11
sp|B2GV38|UBL4A_RAT Ubiquitin-like protein 4A OS=Rattus norvegicus GN=Ubl4a PE=2 SV=1 153 224 5.0E-11
sp|B2GV38|UBL4A_RAT Ubiquitin-like protein 4A OS=Rattus norvegicus GN=Ubl4a PE=2 SV=1 229 300 5.0E-11
sp|P21126|UBL4A_MOUSE Ubiquitin-like protein 4A OS=Mus musculus GN=Ubl4a PE=1 SV=1 1 72 6.0E-11
sp|P21126|UBL4A_MOUSE Ubiquitin-like protein 4A OS=Mus musculus GN=Ubl4a PE=1 SV=1 77 148 6.0E-11
sp|P21126|UBL4A_MOUSE Ubiquitin-like protein 4A OS=Mus musculus GN=Ubl4a PE=1 SV=1 153 224 6.0E-11
sp|P21126|UBL4A_MOUSE Ubiquitin-like protein 4A OS=Mus musculus GN=Ubl4a PE=1 SV=1 229 300 6.0E-11
sp|B2KIK3|UBL4A_RHIFE Ubiquitin-like protein 4A OS=Rhinolophus ferrumequinum GN=UBL4A PE=3 SV=1 1 72 8.0E-11
sp|B2KIK3|UBL4A_RHIFE Ubiquitin-like protein 4A OS=Rhinolophus ferrumequinum GN=UBL4A PE=3 SV=1 77 148 8.0E-11
sp|B2KIK3|UBL4A_RHIFE Ubiquitin-like protein 4A OS=Rhinolophus ferrumequinum GN=UBL4A PE=3 SV=1 153 224 8.0E-11
sp|B2KIK3|UBL4A_RHIFE Ubiquitin-like protein 4A OS=Rhinolophus ferrumequinum GN=UBL4A PE=3 SV=1 229 300 8.0E-11
sp|C1BXU5|UBL4A_ESOLU Ubiquitin-like protein 4A OS=Esox lucius GN=ubl4a PE=2 SV=1 1 75 9.0E-11
sp|C1BXU5|UBL4A_ESOLU Ubiquitin-like protein 4A OS=Esox lucius GN=ubl4a PE=2 SV=1 77 151 9.0E-11
sp|C1BXU5|UBL4A_ESOLU Ubiquitin-like protein 4A OS=Esox lucius GN=ubl4a PE=2 SV=1 153 227 9.0E-11
sp|C1BXU5|UBL4A_ESOLU Ubiquitin-like protein 4A OS=Esox lucius GN=ubl4a PE=2 SV=1 229 303 9.0E-11
sp|B1MTV8|UBL4A_CALMO Ubiquitin-like protein 4A OS=Callicebus moloch GN=UBL4A PE=3 SV=1 1 72 1.0E-10
sp|B1MTV8|UBL4A_CALMO Ubiquitin-like protein 4A OS=Callicebus moloch GN=UBL4A PE=3 SV=1 77 148 1.0E-10
sp|B1MTV8|UBL4A_CALMO Ubiquitin-like protein 4A OS=Callicebus moloch GN=UBL4A PE=3 SV=1 153 224 1.0E-10
sp|B1MTV8|UBL4A_CALMO Ubiquitin-like protein 4A OS=Callicebus moloch GN=UBL4A PE=3 SV=1 229 300 1.0E-10
sp|P11441|UBL4A_HUMAN Ubiquitin-like protein 4A OS=Homo sapiens GN=UBL4A PE=1 SV=1 1 72 1.0E-10
sp|P11441|UBL4A_HUMAN Ubiquitin-like protein 4A OS=Homo sapiens GN=UBL4A PE=1 SV=1 77 148 1.0E-10
sp|P11441|UBL4A_HUMAN Ubiquitin-like protein 4A OS=Homo sapiens GN=UBL4A PE=1 SV=1 153 224 1.0E-10
sp|P11441|UBL4A_HUMAN Ubiquitin-like protein 4A OS=Homo sapiens GN=UBL4A PE=1 SV=1 229 300 1.0E-10
sp|Q5R4T1|UBL4A_PONAB Ubiquitin-like protein 4A OS=Pongo abelii GN=UBL4A PE=2 SV=1 1 72 1.0E-10
sp|Q5R4T1|UBL4A_PONAB Ubiquitin-like protein 4A OS=Pongo abelii GN=UBL4A PE=2 SV=1 77 148 1.0E-10
sp|Q5R4T1|UBL4A_PONAB Ubiquitin-like protein 4A OS=Pongo abelii GN=UBL4A PE=2 SV=1 153 224 1.0E-10
sp|Q5R4T1|UBL4A_PONAB Ubiquitin-like protein 4A OS=Pongo abelii GN=UBL4A PE=2 SV=1 229 300 1.0E-10
sp|B0KWT6|UBL4A_CALJA Ubiquitin-like protein 4A OS=Callithrix jacchus GN=UBL4A PE=3 SV=1 1 72 1.0E-10
sp|B0KWT6|UBL4A_CALJA Ubiquitin-like protein 4A OS=Callithrix jacchus GN=UBL4A PE=3 SV=1 77 148 1.0E-10
sp|B0KWT6|UBL4A_CALJA Ubiquitin-like protein 4A OS=Callithrix jacchus GN=UBL4A PE=3 SV=1 153 224 1.0E-10
sp|B0KWT6|UBL4A_CALJA Ubiquitin-like protein 4A OS=Callithrix jacchus GN=UBL4A PE=3 SV=1 229 300 1.0E-10
sp|B7NZQ9|UBL4A_RABIT Ubiquitin-like protein 4A OS=Oryctolagus cuniculus GN=UBL4A PE=3 SV=1 1 72 2.0E-10
sp|B7NZQ9|UBL4A_RABIT Ubiquitin-like protein 4A OS=Oryctolagus cuniculus GN=UBL4A PE=3 SV=1 77 148 2.0E-10
sp|B7NZQ9|UBL4A_RABIT Ubiquitin-like protein 4A OS=Oryctolagus cuniculus GN=UBL4A PE=3 SV=1 153 224 2.0E-10
sp|B7NZQ9|UBL4A_RABIT Ubiquitin-like protein 4A OS=Oryctolagus cuniculus GN=UBL4A PE=3 SV=1 229 300 2.0E-10
sp|Q15646|OASL_HUMAN 2'-5'-oligoadenylate synthase-like protein OS=Homo sapiens GN=OASL PE=1 SV=2 56 232 6.0E-10
sp|Q15646|OASL_HUMAN 2'-5'-oligoadenylate synthase-like protein OS=Homo sapiens GN=OASL PE=1 SV=2 132 297 7.0E-10
sp|Q7ZWB2|UBL4A_DANRE Ubiquitin-like protein 4A OS=Danio rerio GN=ubl4a PE=2 SV=1 1 75 2.0E-09
sp|Q7ZWB2|UBL4A_DANRE Ubiquitin-like protein 4A OS=Danio rerio GN=ubl4a PE=2 SV=1 77 151 2.0E-09
sp|Q7ZWB2|UBL4A_DANRE Ubiquitin-like protein 4A OS=Danio rerio GN=ubl4a PE=2 SV=1 153 227 2.0E-09
sp|Q7ZWB2|UBL4A_DANRE Ubiquitin-like protein 4A OS=Danio rerio GN=ubl4a PE=2 SV=1 229 303 2.0E-09
sp|B5XFI8|UB4AA_SALSA Ubiquitin-like protein 4A-A OS=Salmo salar GN=ubl4aa PE=2 SV=1 1 75 2.0E-09
sp|B5XFI8|UB4AA_SALSA Ubiquitin-like protein 4A-A OS=Salmo salar GN=ubl4aa PE=2 SV=1 77 151 2.0E-09
sp|B5XFI8|UB4AA_SALSA Ubiquitin-like protein 4A-A OS=Salmo salar GN=ubl4aa PE=2 SV=1 153 227 2.0E-09
sp|B5XFI8|UB4AA_SALSA Ubiquitin-like protein 4A-A OS=Salmo salar GN=ubl4aa PE=2 SV=1 229 303 2.0E-09
sp|Q9SU29|UPL5_ARATH E3 ubiquitin-protein ligase UPL5 OS=Arabidopsis thaliana GN=UPL5 PE=1 SV=1 229 305 2.0E-09
sp|Q9SU29|UPL5_ARATH E3 ubiquitin-protein ligase UPL5 OS=Arabidopsis thaliana GN=UPL5 PE=1 SV=1 1 75 2.0E-09
sp|Q9SU29|UPL5_ARATH E3 ubiquitin-protein ligase UPL5 OS=Arabidopsis thaliana GN=UPL5 PE=1 SV=1 77 151 2.0E-09
sp|Q9SU29|UPL5_ARATH E3 ubiquitin-protein ligase UPL5 OS=Arabidopsis thaliana GN=UPL5 PE=1 SV=1 153 227 2.0E-09
sp|C3KHF2|UBL4A_ANOFI Ubiquitin-like protein 4A OS=Anoplopoma fimbria GN=ubl4a PE=2 SV=1 1 75 2.0E-09
sp|C3KHF2|UBL4A_ANOFI Ubiquitin-like protein 4A OS=Anoplopoma fimbria GN=ubl4a PE=2 SV=1 77 151 2.0E-09
sp|C3KHF2|UBL4A_ANOFI Ubiquitin-like protein 4A OS=Anoplopoma fimbria GN=ubl4a PE=2 SV=1 153 227 2.0E-09
sp|C3KHF2|UBL4A_ANOFI Ubiquitin-like protein 4A OS=Anoplopoma fimbria GN=ubl4a PE=2 SV=1 229 303 2.0E-09
sp|C1BGZ8|UB4AA_ONCMY Ubiquitin-like protein 4A-A OS=Oncorhynchus mykiss GN=ubl4aa PE=2 SV=1 1 75 3.0E-09
sp|C1BGZ8|UB4AA_ONCMY Ubiquitin-like protein 4A-A OS=Oncorhynchus mykiss GN=ubl4aa PE=2 SV=1 77 151 3.0E-09
sp|C1BGZ8|UB4AA_ONCMY Ubiquitin-like protein 4A-A OS=Oncorhynchus mykiss GN=ubl4aa PE=2 SV=1 153 227 3.0E-09
sp|C1BGZ8|UB4AA_ONCMY Ubiquitin-like protein 4A-A OS=Oncorhynchus mykiss GN=ubl4aa PE=2 SV=1 229 303 3.0E-09
sp|B5X9S9|UB4AB_SALSA Ubiquitin-like protein 4A-B OS=Salmo salar GN=ubl4ab PE=2 SV=1 1 75 5.0E-09
sp|B5X9S9|UB4AB_SALSA Ubiquitin-like protein 4A-B OS=Salmo salar GN=ubl4ab PE=2 SV=1 77 151 5.0E-09
sp|B5X9S9|UB4AB_SALSA Ubiquitin-like protein 4A-B OS=Salmo salar GN=ubl4ab PE=2 SV=1 153 227 5.0E-09
sp|B5X9S9|UB4AB_SALSA Ubiquitin-like protein 4A-B OS=Salmo salar GN=ubl4ab PE=2 SV=1 229 303 5.0E-09
sp|C1BHN7|UB4AB_ONCMY Ubiquitin-like protein 4A-B OS=Oncorhynchus mykiss GN=ubl4ab PE=2 SV=1 1 75 7.0E-09
sp|C1BHN7|UB4AB_ONCMY Ubiquitin-like protein 4A-B OS=Oncorhynchus mykiss GN=ubl4ab PE=2 SV=1 77 151 7.0E-09
sp|C1BHN7|UB4AB_ONCMY Ubiquitin-like protein 4A-B OS=Oncorhynchus mykiss GN=ubl4ab PE=2 SV=1 153 227 7.0E-09
sp|C1BHN7|UB4AB_ONCMY Ubiquitin-like protein 4A-B OS=Oncorhynchus mykiss GN=ubl4ab PE=2 SV=1 229 303 7.0E-09
sp|Q0D261|UBL4A_XENLA Ubiquitin-like protein 4A OS=Xenopus laevis GN=ubl4a PE=2 SV=1 1 72 8.0E-09
sp|Q0D261|UBL4A_XENLA Ubiquitin-like protein 4A OS=Xenopus laevis GN=ubl4a PE=2 SV=1 77 148 8.0E-09
sp|Q0D261|UBL4A_XENLA Ubiquitin-like protein 4A OS=Xenopus laevis GN=ubl4a PE=2 SV=1 153 224 8.0E-09
sp|Q0D261|UBL4A_XENLA Ubiquitin-like protein 4A OS=Xenopus laevis GN=ubl4a PE=2 SV=1 229 300 8.0E-09
sp|A4QND0|UBL4A_XENTR Ubiquitin-like protein 4A OS=Xenopus tropicalis GN=ubl4a PE=2 SV=1 1 72 8.0E-09
sp|A4QND0|UBL4A_XENTR Ubiquitin-like protein 4A OS=Xenopus tropicalis GN=ubl4a PE=2 SV=1 77 148 8.0E-09
sp|A4QND0|UBL4A_XENTR Ubiquitin-like protein 4A OS=Xenopus tropicalis GN=ubl4a PE=2 SV=1 153 224 8.0E-09
sp|A4QND0|UBL4A_XENTR Ubiquitin-like protein 4A OS=Xenopus tropicalis GN=ubl4a PE=2 SV=1 229 300 8.0E-09
sp|Q15646|OASL_HUMAN 2'-5'-oligoadenylate synthase-like protein OS=Homo sapiens GN=OASL PE=1 SV=2 13 156 6.0E-08
sp|Q8VI94|OASL1_MOUSE 2'-5'-oligoadenylate synthase-like protein 1 OS=Mus musculus GN=Oasl1 PE=2 SV=1 1 143 6.0E-08
sp|Q8VI94|OASL1_MOUSE 2'-5'-oligoadenylate synthase-like protein 1 OS=Mus musculus GN=Oasl1 PE=2 SV=1 77 219 6.0E-08
sp|Q8VI94|OASL1_MOUSE 2'-5'-oligoadenylate synthase-like protein 1 OS=Mus musculus GN=Oasl1 PE=2 SV=1 153 295 6.0E-08
sp|O60260|PRKN2_HUMAN E3 ubiquitin-protein ligase parkin OS=Homo sapiens GN=PARK2 PE=1 SV=2 229 305 4.0E-07
sp|Q9WVS6|PRKN2_MOUSE E3 ubiquitin-protein ligase parkin OS=Mus musculus GN=Park2 PE=1 SV=1 1 74 4.0E-07
sp|Q9WVS6|PRKN2_MOUSE E3 ubiquitin-protein ligase parkin OS=Mus musculus GN=Park2 PE=1 SV=1 77 150 4.0E-07
sp|Q9WVS6|PRKN2_MOUSE E3 ubiquitin-protein ligase parkin OS=Mus musculus GN=Park2 PE=1 SV=1 153 226 4.0E-07
sp|Q9WVS6|PRKN2_MOUSE E3 ubiquitin-protein ligase parkin OS=Mus musculus GN=Park2 PE=1 SV=1 229 302 4.0E-07
sp|P05161|ISG15_HUMAN Ubiquitin-like protein ISG15 OS=Homo sapiens GN=ISG15 PE=1 SV=5 1 76 5.0E-07
sp|Q9JK66|PRKN2_RAT E3 ubiquitin-protein ligase parkin OS=Rattus norvegicus GN=Park2 PE=1 SV=1 1 72 5.0E-07
sp|Q9JK66|PRKN2_RAT E3 ubiquitin-protein ligase parkin OS=Rattus norvegicus GN=Park2 PE=1 SV=1 77 148 5.0E-07
sp|Q9JK66|PRKN2_RAT E3 ubiquitin-protein ligase parkin OS=Rattus norvegicus GN=Park2 PE=1 SV=1 153 224 5.0E-07
sp|Q9JK66|PRKN2_RAT E3 ubiquitin-protein ligase parkin OS=Rattus norvegicus GN=Park2 PE=1 SV=1 229 300 5.0E-07
sp|O60260|PRKN2_HUMAN E3 ubiquitin-protein ligase parkin OS=Homo sapiens GN=PARK2 PE=1 SV=2 1 79 8.0E-07
sp|O60260|PRKN2_HUMAN E3 ubiquitin-protein ligase parkin OS=Homo sapiens GN=PARK2 PE=1 SV=2 77 155 8.0E-07
sp|O60260|PRKN2_HUMAN E3 ubiquitin-protein ligase parkin OS=Homo sapiens GN=PARK2 PE=1 SV=2 153 231 8.0E-07
sp|Q9YHD3|BAG6A_XENLA Large proline-rich protein bag6-A OS=Xenopus laevis GN=Bag6-a PE=2 SV=1 1 72 8.0E-07
sp|Q9YHD3|BAG6A_XENLA Large proline-rich protein bag6-A OS=Xenopus laevis GN=Bag6-a PE=2 SV=1 77 148 8.0E-07
sp|Q9YHD3|BAG6A_XENLA Large proline-rich protein bag6-A OS=Xenopus laevis GN=Bag6-a PE=2 SV=1 153 224 8.0E-07
sp|Q9YHD3|BAG6A_XENLA Large proline-rich protein bag6-A OS=Xenopus laevis GN=Bag6-a PE=2 SV=1 229 300 8.0E-07
sp|Q19KS6|UBL4B_MONDO Ubiquitin-like protein 4B OS=Monodelphis domestica GN=UBL4B PE=2 SV=1 1 72 9.0E-07
sp|Q19KS6|UBL4B_MONDO Ubiquitin-like protein 4B OS=Monodelphis domestica GN=UBL4B PE=2 SV=1 77 148 9.0E-07
sp|Q19KS6|UBL4B_MONDO Ubiquitin-like protein 4B OS=Monodelphis domestica GN=UBL4B PE=2 SV=1 153 224 9.0E-07
sp|Q19KS6|UBL4B_MONDO Ubiquitin-like protein 4B OS=Monodelphis domestica GN=UBL4B PE=2 SV=1 229 300 9.0E-07
sp|A7X5R6|BAG6_ORNAN Large proline-rich protein BAG6 OS=Ornithorhynchus anatinus GN=BAG6 PE=3 SV=1 1 72 1.0E-06
sp|A7X5R6|BAG6_ORNAN Large proline-rich protein BAG6 OS=Ornithorhynchus anatinus GN=BAG6 PE=3 SV=1 77 148 1.0E-06
sp|A7X5R6|BAG6_ORNAN Large proline-rich protein BAG6 OS=Ornithorhynchus anatinus GN=BAG6 PE=3 SV=1 153 224 1.0E-06
sp|A7X5R6|BAG6_ORNAN Large proline-rich protein BAG6 OS=Ornithorhynchus anatinus GN=BAG6 PE=3 SV=1 229 300 1.0E-06
sp|A4IH17|BAG6_XENTR Large proline-rich protein bag6 OS=Xenopus tropicalis GN=Bag6 PE=2 SV=1 1 72 1.0E-06
sp|A4IH17|BAG6_XENTR Large proline-rich protein bag6 OS=Xenopus tropicalis GN=Bag6 PE=2 SV=1 77 148 1.0E-06
sp|A4IH17|BAG6_XENTR Large proline-rich protein bag6 OS=Xenopus tropicalis GN=Bag6 PE=2 SV=1 153 224 1.0E-06
sp|A4IH17|BAG6_XENTR Large proline-rich protein bag6 OS=Xenopus tropicalis GN=Bag6 PE=2 SV=1 229 300 1.0E-06
sp|P62865|UBIM_BOVIN Ubiquitin-like protein FUBI OS=Bos taurus GN=FAU PE=3 SV=1 1 76 2.0E-06
sp|P62865|UBIM_BOVIN Ubiquitin-like protein FUBI OS=Bos taurus GN=FAU PE=3 SV=1 77 152 2.0E-06
sp|P62865|UBIM_BOVIN Ubiquitin-like protein FUBI OS=Bos taurus GN=FAU PE=3 SV=1 153 228 2.0E-06
sp|P62865|UBIM_BOVIN Ubiquitin-like protein FUBI OS=Bos taurus GN=FAU PE=3 SV=1 229 304 2.0E-06
sp|A7E320|UHRF1_BOVIN E3 ubiquitin-protein ligase UHRF1 OS=Bos taurus GN=UHRF1 PE=2 SV=1 1 98 2.0E-06
sp|A7E320|UHRF1_BOVIN E3 ubiquitin-protein ligase UHRF1 OS=Bos taurus GN=UHRF1 PE=2 SV=1 77 174 2.0E-06
sp|A7E320|UHRF1_BOVIN E3 ubiquitin-protein ligase UHRF1 OS=Bos taurus GN=UHRF1 PE=2 SV=1 153 250 2.0E-06
sp|P0C2F1|UBIM_PONAB Ubiquitin-like protein FUBI OS=Pongo abelii GN=FAU PE=3 SV=1 1 76 3.0E-06
sp|P0C2F1|UBIM_PONAB Ubiquitin-like protein FUBI OS=Pongo abelii GN=FAU PE=3 SV=1 77 152 3.0E-06
sp|P0C2F1|UBIM_PONAB Ubiquitin-like protein FUBI OS=Pongo abelii GN=FAU PE=3 SV=1 153 228 3.0E-06
sp|P0C2F1|UBIM_PONAB Ubiquitin-like protein FUBI OS=Pongo abelii GN=FAU PE=3 SV=1 229 304 3.0E-06
sp|Q6PA26|BAG6B_XENLA Large proline-rich protein bag6-B OS=Xenopus laevis GN=Bag6-b PE=2 SV=1 1 72 4.0E-06
sp|Q6PA26|BAG6B_XENLA Large proline-rich protein bag6-B OS=Xenopus laevis GN=Bag6-b PE=2 SV=1 77 148 4.0E-06
sp|Q6PA26|BAG6B_XENLA Large proline-rich protein bag6-B OS=Xenopus laevis GN=Bag6-b PE=2 SV=1 153 224 4.0E-06
sp|Q6PA26|BAG6B_XENLA Large proline-rich protein bag6-B OS=Xenopus laevis GN=Bag6-b PE=2 SV=1 229 300 4.0E-06
sp|O02741|ISG15_BOVIN Ubiquitin-like protein ISG15 OS=Bos taurus GN=ISG15 PE=2 SV=3 3 76 5.0E-06
sp|Q64339|ISG15_MOUSE Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15 PE=1 SV=4 1 76 6.0E-06
sp|Q2T9Q2|UBL4B_BOVIN Ubiquitin-like protein 4B OS=Bos taurus GN=UBL4B PE=2 SV=1 1 72 8.0E-06
sp|Q2T9Q2|UBL4B_BOVIN Ubiquitin-like protein 4B OS=Bos taurus GN=UBL4B PE=2 SV=1 77 148 8.0E-06
sp|Q2T9Q2|UBL4B_BOVIN Ubiquitin-like protein 4B OS=Bos taurus GN=UBL4B PE=2 SV=1 153 224 8.0E-06
sp|Q2T9Q2|UBL4B_BOVIN Ubiquitin-like protein 4B OS=Bos taurus GN=UBL4B PE=2 SV=1 229 300 8.0E-06
sp|Q05474|UBIM_RAT Ubiquitin-like protein FUBI OS=Rattus norvegicus GN=Fau PE=3 SV=1 1 76 1.0E-05
sp|Q05474|UBIM_RAT Ubiquitin-like protein FUBI OS=Rattus norvegicus GN=Fau PE=3 SV=1 77 152 1.0E-05
sp|Q05474|UBIM_RAT Ubiquitin-like protein FUBI OS=Rattus norvegicus GN=Fau PE=3 SV=1 153 228 1.0E-05
sp|Q05474|UBIM_RAT Ubiquitin-like protein FUBI OS=Rattus norvegicus GN=Fau PE=3 SV=1 229 304 1.0E-05
[Show less]

GO

GO Term Description Terminal node
GO:0005515 protein binding Yes
GO:0003674 molecular_function No
GO:0005488 binding No

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
No 1 - 20 0.45

Transmembrane Domains

(None)

Transcription Factor Class

(None)

Expression data

No expression data available for this genome

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Hirsu2|1910
MQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRLRG
GMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRLR
GGMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRL
RGGMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLR
LRGGQ*
Coding >Hirsu2|1910
ATGCAGATCTTCGTCAAGACTCTCACGGGCAAGACCATCACCCTTGAGGTGGAGTCGTCCGATACCATCGACAAT
GTGAAGTCGAAGATTCAGGACAAGGAGGGCATTCCCCCCGATCAGCAGCGCCTGATCTTCGCCGGTAAACAACTC
GAGGATGGCCGGACCCTCTCCGACTACAACATTCAGAAGGAGTCGACCCTTCACCTCGTCCTCCGCCTTCGTGGT
GGCATGCAGATCTTCGTCAAGACCCTCACCGGAAAGACTATCACCCTCGAGGTGGAGTCCTCGGATACGATTGAC
AACGTCAAGTCGAAAATCCAGGACAAAGAGGGCATTCCCCCGGATCAGCAGCGCCTAATCTTCGCCGGCAAGCAA
CTCGAAGACGGCCGGACGCTCTCCGACTACAACATTCAGAAAGAGTCAACCCTGCACCTCGTCCTTCGTCTGCGT
GGCGGTATGCAGATTTTCGTCAAGACGTTGACGGGGAAAACCATCACCCTGGAAGTTGAATCCTCCGACACGATC
GACAACGTGAAATCGAAGATCCAGGACAAGGAAGGCATCCCCCCGGACCAGCAGCGACTCATCTTTGCCGGCAAG
CAGCTTGAGGACGGCCGCACCCTGAGTGACTACAACATTCAGAAGGAGAGCACTCTGCATCTCGTGTTACGTCTG
CGAGGTGGAATGCAGATTTTCGTCAAAACCCTGACCGGCAAGACCATCACGCTGGAAGTCGAATCTAGCGACACC
ATCGACAATGTCAAGTCCAAGATTCAAGATAAGGAGGGCATCCCTCCTGACCAGCAGCGACTGATTTTTGCCGGC
AAGCAGTTGGAGGATGGCCGCACCTTGAGCGACTATAACATCCAAAAGGAGAGCACTTTGCACCTGGTGCTGCGA
CTCCGTGGCGGCCAGTAG
Transcript >Hirsu2|1910
ATGCAGATCTTCGTCAAGACTCTCACGGGCAAGACCATCACCCTTGAGGTGGAGTCGTCCGATACCATCGACAAT
GTGAAGTCGAAGATTCAGGACAAGGAGGGCATTCCCCCCGATCAGCAGCGCCTGATCTTCGCCGGTAAACAACTC
GAGGATGGCCGGACCCTCTCCGACTACAACATTCAGAAGGAGTCGACCCTTCACCTCGTCCTCCGCCTTCGTGGT
GGCATGCAGATCTTCGTCAAGACCCTCACCGGAAAGACTATCACCCTCGAGGTGGAGTCCTCGGATACGATTGAC
AACGTCAAGTCGAAAATCCAGGACAAAGAGGGCATTCCCCCGGATCAGCAGCGCCTAATCTTCGCCGGCAAGCAA
CTCGAAGACGGCCGGACGCTCTCCGACTACAACATTCAGAAAGAGTCAACCCTGCACCTCGTCCTTCGTCTGCGT
GGCGGTATGCAGATTTTCGTCAAGACGTTGACGGGGAAAACCATCACCCTGGAAGTTGAATCCTCCGACACGATC
GACAACGTGAAATCGAAGATCCAGGACAAGGAAGGCATCCCCCCGGACCAGCAGCGACTCATCTTTGCCGGCAAG
CAGCTTGAGGACGGCCGCACCCTGAGTGACTACAACATTCAGAAGGAGAGCACTCTGCATCTCGTGTTACGTCTG
CGAGGTGGAATGCAGATTTTCGTCAAAACCCTGACCGGCAAGACCATCACGCTGGAAGTCGAATCTAGCGACACC
ATCGACAATGTCAAGTCCAAGATTCAAGATAAGGAGGGCATCCCTCCTGACCAGCAGCGACTGATTTTTGCCGGC
AAGCAGTTGGAGGATGGCCGCACCTTGAGCGACTATAACATCCAAAAGGAGAGCACTTTGCACCTGGTGCTGCGA
CTCCGTGGCGGCCAGTAG
Gene >Hirsu2|1910
ATGCAGATCTTCGTCAAGACTCGTGAGTCCCCCTCTCGTCGGCCACGGCGGCAAACATCTGCCATCGCTCCGCAA
CCGGATGCTGACCTCCGTCTTCTCTCGCAGTCACGGGCAAGACCATCACCCTTGAGGTGGAGTCGTCCGATACCA
TCGACAATGTGAAGTCGAAGATTCAGGACAAGGAGGGCATTCCCCCCGATCAGCAGCGCCTGATCTTCGCCGGTA
AACAACTCGAGGATGGCCGGACCCTCTCCGACTACAACATTCAGAAGGAGTCGACCCTTCACCTCGTCCTCCGCC
TTCGTGGTGGCATGCAGATCTGTATGTTCTCTATTCTCAGGCCACGTCGGTCCCGCCACATTCAGTCTACTGACC
ATATCTCGCAGTCGTCAAGACCCTCACCGGAAAGACTATCACCCTCGAGGTGGAGTCCTCGGATACGATTGACAA
CGTCAAGTCGAAAATCCAGGACAAAGAGGGCATTCCCCCGGATCAGCAGCGCCTAATCTTCGCCGGCAAGCAACT
CGAAGACGGCCGGACGCTCTCCGACTACAACATTCAGAAAGAGTCAACCCTGCACCTCGTCCTTCGTCTGCGTGG
CGGTATGCAGATTTTCGTCAAGACGTTGACGGGGAAAACCATCACCCTGGAAGTTGAATCCTCCGACACGATCGA
CAACGTGAAATCGAAGATCCAGGACAAGGAAGGCATCCCCCCGGACCAGCAGCGACTCATCTTTGCCGGCAAGCA
GCTTGAGGACGGCCGCACCCTGAGTGACTACAACATTCAGAAGGAGAGCACTCTGCATCTCGTGTTACGTCTGCG
AGGTGGAATGCAGATTTTCGTCAAAACCCTGACCGGCAAGACCATCACGCTGGAAGTCGAATCTAGCGACACCAT
CGACAATGTCAAGTCCAAGATTCAAGATAAGGAGGGCATCCCTCCTGACCAGCAGCGACTGATTTTTGCCGGCAA
GCAGTTGGAGGATGGCCGCACCTTGAGCGACTATAACATCCAAAAGGAGAGCACTTTGCACCTGGTGCTGCGACT
CCGTGGCGGCCAGTAG

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail