Fungal Genomics

at Utrecht University

General Properties

Protein IDHirsu2|1910
Gene name
LocationContig_1438:657..1723
Strand-
Gene length (bp)1066
Transcript length (bp)918
Coding sequence length (bp)918
Protein length (aa) 306

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF00240 ubiquitin Ubiquitin family 1.5E-32 3 74
PF00240 ubiquitin Ubiquitin family 1.5E-32 79 150
PF00240 ubiquitin Ubiquitin family 1.5E-32 155 226
PF00240 ubiquitin Ubiquitin family 1.5E-32 231 302
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 1.6E-15 1 71
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 1.6E-15 77 147
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 1.6E-15 153 223
PF11976 Rad60-SLD Ubiquitin-2 like Rad60 SUMO-like 1.6E-15 229 299
PF14560 Ubiquitin_2 Ubiquitin-like domain 1.0E-03 12 69
PF14560 Ubiquitin_2 Ubiquitin-like domain 9.2E-04 87 145
PF14560 Ubiquitin_2 Ubiquitin-like domain 9.2E-04 163 221
PF14560 Ubiquitin_2 Ubiquitin-like domain 9.2E-04 239 297
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.5E-01 15 71
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.4E-01 89 147
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.4E-01 165 223
PF13881 Rad60-SLD_2 Ubiquitin-2 like Rad60 SUMO-like 1.4E-01 241 299

Swissprot hits

[Show all]
Swissprot ID Swissprot Description Start End E-value
sp|P0CG74|UBI4P_CANAX Polyubiquitin OS=Candida albicans GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG63|UBI4P_YEAST Polyubiquitin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG63|UBI4P_YEAST Polyubiquitin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=UBI4 PE=1 SV=1 1 304 0.0E+00
[Show all]
[Show less]
Swissprot ID Swissprot Description Start End E-value
sp|P0CG74|UBI4P_CANAX Polyubiquitin OS=Candida albicans GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG63|UBI4P_YEAST Polyubiquitin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG63|UBI4P_YEAST Polyubiquitin OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=UBI4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG72|UBI4P_SCHPO Polyubiquitin OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P0CG72|UBI4P_SCHPO Polyubiquitin OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi4 PE=1 SV=1 1 304 0.0E+00
sp|P69309|UBIQP_AVEFA Polyubiquitin OS=Avena fatua PE=2 SV=2 1 305 0.0E+00
sp|Q3E7T8|UBQ14_ARATH Polyubiquitin 14 OS=Arabidopsis thaliana GN=UBQ14 PE=1 SV=2 1 304 0.0E+00
sp|P69325|UBIQP_SOYBN Polyubiquitin OS=Glycine max GN=SUBI-1 PE=2 SV=2 1 304 0.0E+00
sp|Q1EC66|UBQ3_ARATH Polyubiquitin 3 OS=Arabidopsis thaliana GN=UBQ3 PE=1 SV=1 1 304 0.0E+00
sp|P0CG70|UBI4P_NEUCR Polyubiquitin OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi PE=1 SV=1 1 305 0.0E+00
sp|P69322|UBIQP_PEA Polyubiquitin OS=Pisum sativum GN=PU1 PE=2 SV=2 1 304 0.0E+00
sp|P69322|UBIQP_PEA Polyubiquitin OS=Pisum sativum GN=PU1 PE=2 SV=2 1 304 0.0E+00
sp|P0CH32|UBQ4_ARATH Polyubiquitin 4 OS=Arabidopsis thaliana GN=UBQ4 PE=1 SV=1 1 304 0.0E+00
sp|P0CH32|UBQ4_ARATH Polyubiquitin 4 OS=Arabidopsis thaliana GN=UBQ4 PE=1 SV=1 1 304 0.0E+00
sp|Q58G87|UBQ3_ORYSJ Polyubiquitin 3 OS=Oryza sativa subsp. japonica GN=UBQ3 PE=2 SV=2 1 304 0.0E+00
sp|Q58G87|UBQ3_ORYSJ Polyubiquitin 3 OS=Oryza sativa subsp. japonica GN=UBQ3 PE=2 SV=2 1 304 0.0E+00
sp|P0CG84|UBI4P_NICSY Polyubiquitin (Fragment) OS=Nicotiana sylvestris GN=UBI4 PE=2 SV=1 1 304 0.0E+00
sp|P0CG84|UBI4P_NICSY Polyubiquitin (Fragment) OS=Nicotiana sylvestris GN=UBI4 PE=2 SV=1 5 304 0.0E+00
sp|Q8H159|UBQ10_ARATH Polyubiquitin 10 OS=Arabidopsis thaliana GN=UBQ10 PE=1 SV=2 1 304 0.0E+00
sp|Q8H159|UBQ10_ARATH Polyubiquitin 10 OS=Arabidopsis thaliana GN=UBQ10 PE=1 SV=2 1 304 0.0E+00
sp|Q8H159|UBQ10_ARATH Polyubiquitin 10 OS=Arabidopsis thaliana GN=UBQ10 PE=1 SV=2 1 304 0.0E+00
sp|P0CG85|UBI1P_NICSY Polyubiquitin OS=Nicotiana sylvestris GN=UBI11 PE=2 SV=1 1 304 0.0E+00
sp|P0CG85|UBI1P_NICSY Polyubiquitin OS=Nicotiana sylvestris GN=UBI11 PE=2 SV=1 1 304 0.0E+00
sp|P0CG85|UBI1P_NICSY Polyubiquitin OS=Nicotiana sylvestris GN=UBI11 PE=2 SV=1 1 304 0.0E+00
sp|P0CH05|UBI2P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-2 PE=3 SV=1 1 304 0.0E+00
sp|P0CH05|UBI2P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-2 PE=3 SV=1 1 304 0.0E+00
sp|P0CH05|UBI2P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-2 PE=3 SV=1 1 304 0.0E+00
sp|P0CH04|UBI1P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=2 SV=1 1 304 0.0E+00
sp|P0CH04|UBI1P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=2 SV=1 1 304 0.0E+00
sp|P0CH04|UBI1P_PETCR Polyubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=2 SV=1 1 304 0.0E+00
sp|P0CH27|RL402_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi PE=2 SV=1 1 304 0.0E+00
sp|P0CG53|UBB_BOVIN Polyubiquitin-B OS=Bos taurus GN=UBB PE=1 SV=1 1 304 0.0E+00
sp|P42739|UBIQP_ACEPE Polyubiquitin (Fragment) OS=Acetabularia peniculus PE=3 SV=2 1 304 0.0E+00
sp|P42739|UBIQP_ACEPE Polyubiquitin (Fragment) OS=Acetabularia peniculus PE=3 SV=2 1 304 0.0E+00
sp|P42739|UBIQP_ACEPE Polyubiquitin (Fragment) OS=Acetabularia peniculus PE=3 SV=2 36 304 0.0E+00
sp|P0CG54|UBB_CAVPO Polyubiquitin-B OS=Cavia porcellus GN=UBB PE=2 SV=1 1 304 0.0E+00
sp|P0CG51|UBB_RAT Polyubiquitin-B OS=Rattus norvegicus GN=Ubb PE=1 SV=1 1 304 0.0E+00
sp|P0CG49|UBB_MOUSE Polyubiquitin-B OS=Mus musculus GN=Ubb PE=2 SV=1 1 304 0.0E+00
sp|P0CG62|UBB_CHICK Polyubiquitin-B OS=Gallus gallus GN=UBB PE=2 SV=1 1 304 0.0E+00
sp|P0CG55|UBB_SHEEP Polyubiquitin-B OS=Ovis aries GN=UBB PE=2 SV=1 1 304 0.0E+00
sp|P42740|UBIQP_AGLNE Polyubiquitin OS=Aglaothamnion neglectum PE=2 SV=2 1 304 0.0E+00
sp|P42740|UBIQP_AGLNE Polyubiquitin OS=Aglaothamnion neglectum PE=2 SV=2 1 304 0.0E+00
sp|P42740|UBIQP_AGLNE Polyubiquitin OS=Aglaothamnion neglectum PE=2 SV=2 1 304 0.0E+00
sp|Q8MKD1|UBB_HORSE Polyubiquitin-B OS=Equus caballus GN=UBB PE=2 SV=3 1 304 0.0E+00
sp|P59669|UBIQP_GEOCY Polyubiquitin OS=Geodia cydonium PE=2 SV=2 1 304 0.0E+00
sp|P59669|UBIQP_GEOCY Polyubiquitin OS=Geodia cydonium PE=2 SV=2 1 304 0.0E+00
sp|P59669|UBIQP_GEOCY Polyubiquitin OS=Geodia cydonium PE=2 SV=2 1 304 0.0E+00
sp|P0CG82|UBIQP_TETPY Polyubiquitin OS=Tetrahymena pyriformis GN=TU20 PE=3 SV=1 1 305 0.0E+00
sp|P0CG82|UBIQP_TETPY Polyubiquitin OS=Tetrahymena pyriformis GN=TU20 PE=3 SV=1 1 304 0.0E+00
sp|P0CG88|UBIQJ_DICDI Polyubiquitin-J OS=Dictyostelium discoideum GN=ubqJ PE=1 SV=1 1 304 0.0E+00
sp|P0CG80|UBIQI_DICDI Polyubiquitin-I OS=Dictyostelium discoideum GN=ubqI PE=1 SV=1 1 304 0.0E+00
sp|P0CG81|UBIQH_DICDI Polyubiquitin-H OS=Dictyostelium discoideum GN=ubqH PE=1 SV=1 1 304 0.0E+00
sp|P0CG81|UBIQH_DICDI Polyubiquitin-H OS=Dictyostelium discoideum GN=ubqH PE=1 SV=1 1 304 0.0E+00
sp|P0CG68|UBC_PIG Polyubiquitin-C OS=Sus scrofa GN=UBC PE=2 SV=1 1 304 0.0E+00
sp|P0CG68|UBC_PIG Polyubiquitin-C OS=Sus scrofa GN=UBC PE=2 SV=1 1 304 0.0E+00
sp|P0CG68|UBC_PIG Polyubiquitin-C OS=Sus scrofa GN=UBC PE=2 SV=1 1 304 0.0E+00
sp|P0CG68|UBC_PIG Polyubiquitin-C OS=Sus scrofa GN=UBC PE=2 SV=1 1 304 0.0E+00
sp|P0CG79|UBIQG_DICDI Polyubiquitin-G OS=Dictyostelium discoideum GN=ubqG PE=1 SV=1 1 304 0.0E+00
sp|P0CG79|UBIQG_DICDI Polyubiquitin-G OS=Dictyostelium discoideum GN=ubqG PE=1 SV=1 1 304 0.0E+00
sp|P0CG76|UBIQA_DICDI Polyubiquitin-A OS=Dictyostelium discoideum GN=ubqA PE=1 SV=1 1 304 0.0E+00
sp|P0CG76|UBIQA_DICDI Polyubiquitin-A OS=Dictyostelium discoideum GN=ubqA PE=1 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG71|UBIQ1_CAEEL Polyubiquitin-A OS=Caenorhabditis elegans GN=ubq-1 PE=3 SV=1 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 304 0.0E+00
sp|P0CG78|UBIQF_DICDI Polyubiquitin-F OS=Dictyostelium discoideum GN=ubqF PE=1 SV=1 1 304 0.0E+00
sp|P0CG78|UBIQF_DICDI Polyubiquitin-F OS=Dictyostelium discoideum GN=ubqF PE=1 SV=1 1 304 0.0E+00
sp|P0CG78|UBIQF_DICDI Polyubiquitin-F OS=Dictyostelium discoideum GN=ubqF PE=1 SV=1 1 304 0.0E+00
sp|P0CG78|UBIQF_DICDI Polyubiquitin-F OS=Dictyostelium discoideum GN=ubqF PE=1 SV=1 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 304 0.0E+00
sp|Q9FHQ6|UBQ9_ARATH Polyubiquitin 9 OS=Arabidopsis thaliana GN=UBQ9 PE=3 SV=1 1 305 0.0E+00
sp|P69315|UBIQP_LINUS Polyubiquitin (Fragment) OS=Linum usitatissimum PE=3 SV=2 36 304 0.0E+00
sp|P69315|UBIQP_LINUS Polyubiquitin (Fragment) OS=Linum usitatissimum PE=3 SV=2 1 264 0.0E+00
sp|P62976|UBIQP_CRIGR Polyubiquitin OS=Cricetulus griseus PE=2 SV=2 1 260 9.0E-163
sp|P0CG50|UBC_MOUSE Polyubiquitin-C OS=Mus musculus GN=Ubc PE=1 SV=2 1 255 9.0E-161
sp|Q63429|UBC_RAT Polyubiquitin-C OS=Rattus norvegicus GN=Ubc PE=1 SV=1 1 255 7.0E-160
sp|P0CG73|UBI1P_CANAX Polyubiquitin OS=Candida albicans GN=UBI1 PE=1 SV=1 1 229 4.0E-158
sp|P0CG73|UBI1P_CANAX Polyubiquitin OS=Candida albicans GN=UBI1 PE=1 SV=1 77 304 5.0E-158
sp|P0CH33|UBQ11_ARATH Polyubiquitin 11 OS=Arabidopsis thaliana GN=UBQ11 PE=1 SV=1 1 229 2.0E-157
sp|P0CH33|UBQ11_ARATH Polyubiquitin 11 OS=Arabidopsis thaliana GN=UBQ11 PE=1 SV=1 77 304 3.0E-157
sp|P0CG75|UBI4P_KLULA Polyubiquitin OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi4 PE=1 SV=1 1 229 5.0E-157
sp|P0CG72|UBI4P_SCHPO Polyubiquitin OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi4 PE=1 SV=1 1 229 6.0E-157
sp|Q39256|UBQ8_ARATH Polyubiquitin 8 OS=Arabidopsis thaliana GN=UBQ8 PE=3 SV=1 1 304 8.0E-156
sp|Q58G87|UBQ3_ORYSJ Polyubiquitin 3 OS=Oryza sativa subsp. japonica GN=UBQ3 PE=2 SV=2 1 229 3.0E-155
sp|P0CG60|UBB_PONPY Polyubiquitin-B OS=Pongo pygmaeus GN=UBB PE=3 SV=1 1 229 4.0E-154
sp|P0CG60|UBB_PONPY Polyubiquitin-B OS=Pongo pygmaeus GN=UBB PE=3 SV=1 77 304 4.0E-154
sp|P0CG65|UBB_PANTR Polyubiquitin-B OS=Pan troglodytes GN=UBB PE=3 SV=1 1 229 4.0E-154
sp|P0CG65|UBB_PANTR Polyubiquitin-B OS=Pan troglodytes GN=UBB PE=3 SV=1 77 304 4.0E-154
sp|P0CG47|UBB_HUMAN Polyubiquitin-B OS=Homo sapiens GN=UBB PE=1 SV=1 1 229 4.0E-154
sp|P0CG47|UBB_HUMAN Polyubiquitin-B OS=Homo sapiens GN=UBB PE=1 SV=1 77 304 4.0E-154
sp|P0CG67|UBB_GORGO Polyubiquitin-B OS=Gorilla gorilla gorilla GN=UBB PE=3 SV=1 1 229 4.0E-154
sp|P0CG67|UBB_GORGO Polyubiquitin-B OS=Gorilla gorilla gorilla GN=UBB PE=3 SV=1 77 304 4.0E-154
sp|P0CH27|RL402_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi PE=2 SV=1 1 229 2.0E-153
sp|P42740|UBIQP_AGLNE Polyubiquitin OS=Aglaothamnion neglectum PE=2 SV=2 1 229 6.0E-153
sp|P0CG54|UBB_CAVPO Polyubiquitin-B OS=Cavia porcellus GN=UBB PE=2 SV=1 1 229 8.0E-153
sp|P23324|UBIQP_EUPEU Polyubiquitin OS=Euplotes eurystomus PE=3 SV=2 1 229 2.0E-152
sp|P23324|UBIQP_EUPEU Polyubiquitin OS=Euplotes eurystomus PE=3 SV=2 77 304 2.0E-152
sp|P0CG77|UBIQD_DICDI Polyubiquitin-D OS=Dictyostelium discoideum GN=ubqD PE=1 SV=1 1 229 2.0E-152
sp|P0CG77|UBIQD_DICDI Polyubiquitin-D OS=Dictyostelium discoideum GN=ubqD PE=1 SV=1 77 304 5.0E-152
sp|P22589|UBIQP_PHYIN Polyubiquitin OS=Phytophthora infestans PE=1 SV=2 1 228 7.0E-151
sp|P22589|UBIQP_PHYIN Polyubiquitin OS=Phytophthora infestans PE=1 SV=2 77 304 7.0E-151
sp|P0CG79|UBIQG_DICDI Polyubiquitin-G OS=Dictyostelium discoideum GN=ubqG PE=1 SV=1 1 229 8.0E-150
sp|P0CG66|UBC_GORGO Polyubiquitin-C OS=Gorilla gorilla gorilla GN=UBC PE=3 SV=1 1 229 2.0E-148
sp|Q3E7K8|UBQ12_ARATH Polyubiquitin 12 OS=Arabidopsis thaliana GN=UBQ12 PE=3 SV=1 1 228 1.0E-147
sp|Q3E7K8|UBQ12_ARATH Polyubiquitin 12 OS=Arabidopsis thaliana GN=UBQ12 PE=3 SV=1 77 304 1.0E-147
sp|P0CG48|UBC_HUMAN Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 1 229 2.0E-147
sp|P0CH28|UBC_BOVIN Polyubiquitin-C OS=Bos taurus GN=UBC PE=1 SV=1 1 229 3.0E-147
sp|P0CG69|UBIQP_DROME Polyubiquitin OS=Drosophila melanogaster GN=Ubi-p63E PE=3 SV=1 1 230 3.0E-147
sp|P0CG61|UBC_PONPY Polyubiquitin-C OS=Pongo pygmaeus GN=UBC PE=3 SV=1 1 229 2.0E-146
sp|P0CG64|UBC_PANTR Polyubiquitin-C OS=Pan troglodytes GN=UBC PE=3 SV=1 1 229 2.0E-146
sp|Q39256|UBQ8_ARATH Polyubiquitin 8 OS=Arabidopsis thaliana GN=UBQ8 PE=3 SV=1 1 302 4.0E-136
sp|Q39256|UBQ8_ARATH Polyubiquitin 8 OS=Arabidopsis thaliana GN=UBQ8 PE=3 SV=1 1 304 2.0E-131
sp|P0CG83|UBIQP_HORVU Polyubiquitin (Fragment) OS=Hordeum vulgare PE=2 SV=1 135 305 8.0E-115
sp|P0CG83|UBIQP_HORVU Polyubiquitin (Fragment) OS=Hordeum vulgare PE=2 SV=1 59 228 1.0E-114
sp|P62972|UBIQP_XENLA Polyubiquitin (Fragment) OS=Xenopus laevis PE=1 SV=2 62 228 2.0E-109
sp|P62972|UBIQP_XENLA Polyubiquitin (Fragment) OS=Xenopus laevis PE=1 SV=2 138 304 2.0E-109
sp|P0CG83|UBIQP_HORVU Polyubiquitin (Fragment) OS=Hordeum vulgare PE=2 SV=1 1 152 2.0E-100
sp|P62972|UBIQP_XENLA Polyubiquitin (Fragment) OS=Xenopus laevis PE=1 SV=2 1 152 5.0E-98
sp|P23398|UBIQP_STRPU Polyubiquitin (Fragment) OS=Strongylocentrotus purpuratus PE=2 SV=2 173 305 1.0E-84
sp|P23398|UBIQP_STRPU Polyubiquitin (Fragment) OS=Strongylocentrotus purpuratus PE=2 SV=2 21 152 7.0E-84
sp|P23398|UBIQP_STRPU Polyubiquitin (Fragment) OS=Strongylocentrotus purpuratus PE=2 SV=2 97 228 7.0E-84
sp|P0C031|RUB2_ORYSJ Ubiquitin-NEDD8-like protein RUB2 OS=Oryza sativa subsp. japonica GN=RUB2 PE=2 SV=2 153 305 2.0E-80
sp|P0C073|RUB1_DESAN Ubiquitin-NEDD8-like protein RUB1 OS=Deschampsia antarctica GN=RUB1 PE=2 SV=2 1 152 5.0E-80
sp|P0C073|RUB1_DESAN Ubiquitin-NEDD8-like protein RUB1 OS=Deschampsia antarctica GN=RUB1 PE=2 SV=2 77 228 5.0E-80
sp|P0C073|RUB1_DESAN Ubiquitin-NEDD8-like protein RUB1 OS=Deschampsia antarctica GN=RUB1 PE=2 SV=2 153 304 5.0E-80
sp|Q9SHE7|RUB1_ARATH Ubiquitin-NEDD8-like protein RUB1 OS=Arabidopsis thaliana GN=RUB1 PE=1 SV=3 1 156 9.0E-80
sp|Q9SHE7|RUB1_ARATH Ubiquitin-NEDD8-like protein RUB1 OS=Arabidopsis thaliana GN=RUB1 PE=1 SV=3 77 232 9.0E-80
sp|P0C031|RUB2_ORYSJ Ubiquitin-NEDD8-like protein RUB2 OS=Oryza sativa subsp. japonica GN=RUB2 PE=2 SV=2 1 152 1.0E-79
sp|P0C031|RUB2_ORYSJ Ubiquitin-NEDD8-like protein RUB2 OS=Oryza sativa subsp. japonica GN=RUB2 PE=2 SV=2 77 228 1.0E-79
sp|Q9SHE7|RUB1_ARATH Ubiquitin-NEDD8-like protein RUB1 OS=Arabidopsis thaliana GN=RUB1 PE=1 SV=3 153 304 1.0E-79
sp|P0C030|RUB1_ORYSJ Ubiquitin-NEDD8-like protein RUB1 OS=Oryza sativa subsp. japonica GN=RUB1 PE=2 SV=2 1 152 1.0E-79
sp|P0C030|RUB1_ORYSJ Ubiquitin-NEDD8-like protein RUB1 OS=Oryza sativa subsp. japonica GN=RUB1 PE=2 SV=2 77 228 1.0E-79
sp|P0C030|RUB1_ORYSJ Ubiquitin-NEDD8-like protein RUB1 OS=Oryza sativa subsp. japonica GN=RUB1 PE=2 SV=2 153 304 1.0E-79
sp|Q8RUC6|RUB2_ARATH Ubiquitin-NEDD8-like protein RUB2 OS=Arabidopsis thaliana GN=RUB2 PE=1 SV=3 1 153 4.0E-79
sp|Q8RUC6|RUB2_ARATH Ubiquitin-NEDD8-like protein RUB2 OS=Arabidopsis thaliana GN=RUB2 PE=1 SV=3 77 229 4.0E-79
sp|Q8RUC6|RUB2_ARATH Ubiquitin-NEDD8-like protein RUB2 OS=Arabidopsis thaliana GN=RUB2 PE=1 SV=3 153 304 9.0E-79
sp|P0C032|RUB3_ORYSJ Ubiquitin-like protein-NEDD8-like protein RUB3 OS=Oryza sativa subsp. japonica GN=RUB3 PE=3 SV=2 1 152 4.0E-76
sp|P0C032|RUB3_ORYSJ Ubiquitin-like protein-NEDD8-like protein RUB3 OS=Oryza sativa subsp. japonica GN=RUB3 PE=3 SV=2 77 228 4.0E-76
sp|P0C032|RUB3_ORYSJ Ubiquitin-like protein-NEDD8-like protein RUB3 OS=Oryza sativa subsp. japonica GN=RUB3 PE=3 SV=2 153 304 4.0E-76
sp|P40909|RL40_CRYNJ Ubiquitin-60S ribosomal protein L40 OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=UBI1 PE=1 SV=2 1 77 1.0E-45
sp|P40909|RL40_CRYNJ Ubiquitin-60S ribosomal protein L40 OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=UBI1 PE=1 SV=2 77 153 1.0E-45
sp|P40909|RL40_CRYNJ Ubiquitin-60S ribosomal protein L40 OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=UBI1 PE=1 SV=2 153 229 1.0E-45
sp|P40909|RL40_CRYNJ Ubiquitin-60S ribosomal protein L40 OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=UBI1 PE=1 SV=2 229 304 2.0E-45
sp|P0CH07|RL402_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=uep1 PE=1 SV=1 1 77 2.0E-45
sp|P0CH07|RL402_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=uep1 PE=1 SV=1 77 153 2.0E-45
sp|P0CH07|RL402_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=uep1 PE=1 SV=1 153 229 2.0E-45
sp|P0CH07|RL402_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=uep1 PE=1 SV=1 229 304 2.0E-45
sp|P0CH06|RL401_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi1 PE=1 SV=1 1 77 2.0E-45
sp|P0CH06|RL401_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi1 PE=1 SV=1 77 153 2.0E-45
sp|P0CH06|RL401_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi1 PE=1 SV=1 153 229 2.0E-45
sp|P0CH06|RL401_SCHPO Ubiquitin-60S ribosomal protein L40 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi1 PE=1 SV=1 229 304 2.0E-45
sp|P0CH09|RL402_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40B PE=1 SV=1 1 77 2.0E-45
sp|P0CH09|RL402_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40B PE=1 SV=1 77 153 2.0E-45
sp|P0CH09|RL402_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40B PE=1 SV=1 153 229 2.0E-45
sp|P0CH08|RL401_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40A PE=1 SV=1 1 77 2.0E-45
sp|P0CH08|RL401_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40A PE=1 SV=1 77 153 2.0E-45
sp|P0CH08|RL401_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40A PE=1 SV=1 153 229 2.0E-45
sp|P0CH09|RL402_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40B PE=1 SV=1 229 304 3.0E-45
sp|P0CH08|RL401_YEAST Ubiquitin-60S ribosomal protein L40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPL40A PE=1 SV=1 229 304 3.0E-45
sp|P69326|UBIQ_WHEAT Ubiquitin OS=Triticum aestivum PE=3 SV=2 229 305 5.0E-45
sp|P51423|RL40_BRARP Ubiquitin-60S ribosomal protein L40 OS=Brassica rapa subsp. pekinensis PE=2 SV=2 1 77 6.0E-45
sp|P51423|RL40_BRARP Ubiquitin-60S ribosomal protein L40 OS=Brassica rapa subsp. pekinensis PE=2 SV=2 77 153 6.0E-45
sp|P51423|RL40_BRARP Ubiquitin-60S ribosomal protein L40 OS=Brassica rapa subsp. pekinensis PE=2 SV=2 153 229 6.0E-45
sp|P51423|RL40_BRARP Ubiquitin-60S ribosomal protein L40 OS=Brassica rapa subsp. pekinensis PE=2 SV=2 229 304 9.0E-45
sp|P49636|RL40_NICSY Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris GN=UBICEP52-7 PE=2 SV=2 1 77 9.0E-45
sp|P49636|RL40_NICSY Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris GN=UBICEP52-7 PE=2 SV=2 77 153 9.0E-45
sp|P49636|RL40_NICSY Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris GN=UBICEP52-7 PE=2 SV=2 153 229 9.0E-45
sp|P0CH35|RL40B_ORYSJ Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-2 PE=3 SV=1 1 77 9.0E-45
sp|P0CH35|RL40B_ORYSJ Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-2 PE=3 SV=1 77 153 9.0E-45
sp|P0CH35|RL40B_ORYSJ Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-2 PE=3 SV=1 153 229 9.0E-45
sp|P0CH34|RL40A_ORYSJ Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-1 PE=2 SV=1 1 77 9.0E-45
sp|P0CH34|RL40A_ORYSJ Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-1 PE=2 SV=1 77 153 9.0E-45
sp|P0CH34|RL40A_ORYSJ Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-1 PE=2 SV=1 153 229 9.0E-45
sp|P49636|RL40_NICSY Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris GN=UBICEP52-7 PE=2 SV=2 229 304 1.0E-44
sp|P0CH35|RL40B_ORYSJ Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-2 PE=3 SV=1 229 304 1.0E-44
sp|P0CH34|RL40A_ORYSJ Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica GN=Ub-CEP52-1 PE=2 SV=1 229 304 1.0E-44
sp|Q42202|RL40B_ARATH Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana GN=RPL40B PE=1 SV=2 1 77 1.0E-44
sp|Q42202|RL40B_ARATH Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana GN=RPL40B PE=1 SV=2 77 153 1.0E-44
sp|Q42202|RL40B_ARATH Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana GN=RPL40B PE=1 SV=2 153 229 1.0E-44
sp|B9DHA6|RL40A_ARATH Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana GN=RPL40A PE=1 SV=1 1 77 1.0E-44
sp|B9DHA6|RL40A_ARATH Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana GN=RPL40A PE=1 SV=1 77 153 1.0E-44
sp|B9DHA6|RL40A_ARATH Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana GN=RPL40A PE=1 SV=1 153 229 1.0E-44
sp|P0C224|RL40_NEUCR Ubiquitin-60S ribosomal protein L40 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=crp-79 PE=1 SV=2 1 77 1.0E-44
sp|P0C224|RL40_NEUCR Ubiquitin-60S ribosomal protein L40 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=crp-79 PE=1 SV=2 77 153 1.0E-44
sp|P0C224|RL40_NEUCR Ubiquitin-60S ribosomal protein L40 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=crp-79 PE=1 SV=2 153 229 1.0E-44
sp|P19848|UBIQ_COPCO Ubiquitin OS=Coprinellus congregatus PE=1 SV=1 1 76 1.0E-44
sp|P19848|UBIQ_COPCO Ubiquitin OS=Coprinellus congregatus PE=1 SV=1 77 152 1.0E-44
sp|P19848|UBIQ_COPCO Ubiquitin OS=Coprinellus congregatus PE=1 SV=1 153 228 1.0E-44
sp|P19848|UBIQ_COPCO Ubiquitin OS=Coprinellus congregatus PE=1 SV=1 229 304 1.0E-44
sp|Q42202|RL40B_ARATH Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana GN=RPL40B PE=1 SV=2 229 304 2.0E-44
sp|B9DHA6|RL40A_ARATH Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana GN=RPL40A PE=1 SV=1 229 304 2.0E-44
sp|P0C224|RL40_NEUCR Ubiquitin-60S ribosomal protein L40 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=crp-79 PE=1 SV=2 229 304 2.0E-44
sp|P69317|UBIQ_LUPPO Ubiquitin OS=Lupinus polyphyllus PE=3 SV=2 1 77 2.0E-44
sp|P69317|UBIQ_LUPPO Ubiquitin OS=Lupinus polyphyllus PE=3 SV=2 77 153 2.0E-44
sp|P69317|UBIQ_LUPPO Ubiquitin OS=Lupinus polyphyllus PE=3 SV=2 153 229 2.0E-44
sp|P69313|UBIQ_HELAN Ubiquitin OS=Helianthus annuus PE=3 SV=2 1 77 2.0E-44
sp|P69313|UBIQ_HELAN Ubiquitin OS=Helianthus annuus PE=3 SV=2 77 153 2.0E-44
sp|P69313|UBIQ_HELAN Ubiquitin OS=Helianthus annuus PE=3 SV=2 153 229 2.0E-44
sp|P69310|UBIQ_AVESA Ubiquitin OS=Avena sativa PE=1 SV=1 1 76 2.0E-44
sp|P69310|UBIQ_AVESA Ubiquitin OS=Avena sativa PE=1 SV=1 77 152 2.0E-44
sp|P69310|UBIQ_AVESA Ubiquitin OS=Avena sativa PE=1 SV=1 153 228 2.0E-44
sp|P69310|UBIQ_AVESA Ubiquitin OS=Avena sativa PE=1 SV=1 229 304 2.0E-44
sp|P69326|UBIQ_WHEAT Ubiquitin OS=Triticum aestivum PE=3 SV=2 1 76 3.0E-44
sp|P69326|UBIQ_WHEAT Ubiquitin OS=Triticum aestivum PE=3 SV=2 77 152 3.0E-44
sp|P69326|UBIQ_WHEAT Ubiquitin OS=Triticum aestivum PE=3 SV=2 153 228 3.0E-44
sp|P69317|UBIQ_LUPPO Ubiquitin OS=Lupinus polyphyllus PE=3 SV=2 229 304 3.0E-44
sp|P69313|UBIQ_HELAN Ubiquitin OS=Helianthus annuus PE=3 SV=2 229 304 3.0E-44
sp|P0CH10|RL403_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI3 PE=1 SV=1 1 77 3.0E-44
sp|P0CH10|RL403_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI3 PE=1 SV=1 77 153 3.0E-44
sp|P0CH10|RL403_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI3 PE=1 SV=1 153 229 3.0E-44
sp|P0CH11|RL401_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI1 PE=1 SV=1 1 77 3.0E-44
sp|P0CH11|RL401_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI1 PE=1 SV=1 77 153 3.0E-44
sp|P0CH11|RL401_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI1 PE=1 SV=1 153 229 3.0E-44
sp|P49632|RL40_CAEEL Ubiquitin-60S ribosomal protein L40 OS=Caenorhabditis elegans GN=ubq-2 PE=3 SV=2 1 77 3.0E-44
sp|P49632|RL40_CAEEL Ubiquitin-60S ribosomal protein L40 OS=Caenorhabditis elegans GN=ubq-2 PE=3 SV=2 77 153 3.0E-44
sp|P49632|RL40_CAEEL Ubiquitin-60S ribosomal protein L40 OS=Caenorhabditis elegans GN=ubq-2 PE=3 SV=2 153 229 3.0E-44
sp|P0CH10|RL403_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI3 PE=1 SV=1 229 304 4.0E-44
sp|P0CH11|RL401_CHLRE Ubiquitin-60S ribosomal protein L40 OS=Chlamydomonas reinhardtii GN=UBI1 PE=1 SV=1 229 304 4.0E-44
sp|P14795|RL40_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi GN=FUS1 PE=2 SV=2 1 77 4.0E-44
sp|P14795|RL40_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi GN=FUS1 PE=2 SV=2 77 153 4.0E-44
sp|P14795|RL40_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi GN=FUS1 PE=2 SV=2 153 229 4.0E-44
sp|Q9ARZ9|R27AA_ORYSJ Ubiquitin-40S ribosomal protein S27a-1 OS=Oryza sativa subsp. japonica GN=RPS27AA PE=2 SV=1 1 76 4.0E-44
sp|Q9ARZ9|R27AA_ORYSJ Ubiquitin-40S ribosomal protein S27a-1 OS=Oryza sativa subsp. japonica GN=RPS27AA PE=2 SV=1 77 152 4.0E-44
sp|Q9ARZ9|R27AA_ORYSJ Ubiquitin-40S ribosomal protein S27a-1 OS=Oryza sativa subsp. japonica GN=RPS27AA PE=2 SV=1 153 228 4.0E-44
sp|Q9ARZ9|R27AA_ORYSJ Ubiquitin-40S ribosomal protein S27a-1 OS=Oryza sativa subsp. japonica GN=RPS27AA PE=2 SV=1 229 304 4.0E-44
sp|P0CG86|RS271_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB1 PE=3 SV=1 1 76 4.0E-44
sp|P0CG86|RS271_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB1 PE=3 SV=1 77 152 4.0E-44
sp|P0CG86|RS271_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB1 PE=3 SV=1 153 228 4.0E-44
sp|P0CG86|RS271_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB1 PE=3 SV=1 229 304 4.0E-44
sp|P49632|RL40_CAEEL Ubiquitin-60S ribosomal protein L40 OS=Caenorhabditis elegans GN=ubq-2 PE=3 SV=2 229 304 5.0E-44
sp|P14795|RL40_TRYCR Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma cruzi GN=FUS1 PE=2 SV=2 229 304 5.0E-44
sp|P27923|RS27A_MAIZE Ubiquitin-40S ribosomal protein S27a OS=Zea mays GN=UBF9 PE=2 SV=2 1 76 5.0E-44
sp|P27923|RS27A_MAIZE Ubiquitin-40S ribosomal protein S27a OS=Zea mays GN=UBF9 PE=2 SV=2 77 152 5.0E-44
sp|P27923|RS27A_MAIZE Ubiquitin-40S ribosomal protein S27a OS=Zea mays GN=UBF9 PE=2 SV=2 153 228 5.0E-44
sp|P27923|RS27A_MAIZE Ubiquitin-40S ribosomal protein S27a OS=Zea mays GN=UBF9 PE=2 SV=2 229 304 5.0E-44
sp|P47905|RS27A_LUPAL Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus PE=3 SV=2 1 76 5.0E-44
sp|P47905|RS27A_LUPAL Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus PE=3 SV=2 77 152 5.0E-44
sp|P47905|RS27A_LUPAL Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus PE=3 SV=2 153 228 5.0E-44
sp|P47905|RS27A_LUPAL Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus PE=3 SV=2 229 304 5.0E-44
sp|P59233|R27AC_ARATH Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana GN=RPS27AC PE=1 SV=2 1 76 6.0E-44
sp|P59233|R27AC_ARATH Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana GN=RPS27AC PE=1 SV=2 77 152 6.0E-44
sp|P59233|R27AC_ARATH Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana GN=RPS27AC PE=1 SV=2 153 228 6.0E-44
sp|P59233|R27AC_ARATH Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana GN=RPS27AC PE=1 SV=2 229 304 6.0E-44
sp|P59232|R27AB_ARATH Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana GN=RPS27AB PE=1 SV=2 1 76 6.0E-44
sp|P59232|R27AB_ARATH Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana GN=RPS27AB PE=1 SV=2 77 152 6.0E-44
sp|P59232|R27AB_ARATH Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana GN=RPS27AB PE=1 SV=2 153 228 6.0E-44
sp|P59232|R27AB_ARATH Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana GN=RPS27AB PE=1 SV=2 229 304 6.0E-44
sp|P51431|R27AB_ORYSJ Ubiquitin-40S ribosomal protein S27a-2 OS=Oryza sativa subsp. japonica GN=RPS27AB PE=2 SV=3 1 76 6.0E-44
sp|P51431|R27AB_ORYSJ Ubiquitin-40S ribosomal protein S27a-2 OS=Oryza sativa subsp. japonica GN=RPS27AB PE=2 SV=3 77 152 6.0E-44
sp|P51431|R27AB_ORYSJ Ubiquitin-40S ribosomal protein S27a-2 OS=Oryza sativa subsp. japonica GN=RPS27AB PE=2 SV=3 153 228 6.0E-44
sp|P51431|R27AB_ORYSJ Ubiquitin-40S ribosomal protein S27a-2 OS=Oryza sativa subsp. japonica GN=RPS27AB PE=2 SV=3 229 304 6.0E-44
sp|P0CG87|RS272_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB2 PE=3 SV=1 1 76 6.0E-44
sp|P0CG87|RS272_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB2 PE=3 SV=1 77 152 6.0E-44
sp|P0CG87|RS272_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB2 PE=3 SV=1 153 228 6.0E-44
sp|P0CG87|RS272_HORVU Ubiquitin-40S ribosomal protein S27a OS=Hordeum vulgare GN=MUB2 PE=3 SV=1 229 304 6.0E-44
sp|P59271|R27AA_ARATH Ubiquitin-40S ribosomal protein S27a-1 OS=Arabidopsis thaliana GN=RPS27AA PE=1 SV=2 1 76 7.0E-44
sp|P59271|R27AA_ARATH Ubiquitin-40S ribosomal protein S27a-1 OS=Arabidopsis thaliana GN=RPS27AA PE=1 SV=2 77 152 7.0E-44
sp|P59271|R27AA_ARATH Ubiquitin-40S ribosomal protein S27a-1 OS=Arabidopsis thaliana GN=RPS27AA PE=1 SV=2 153 228 7.0E-44
sp|P59271|R27AA_ARATH Ubiquitin-40S ribosomal protein S27a-1 OS=Arabidopsis thaliana GN=RPS27AA PE=1 SV=2 229 304 7.0E-44
sp|P62981|RS27A_SOLTU Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum GN=UBI3 PE=2 SV=2 1 76 8.0E-44
sp|P62981|RS27A_SOLTU Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum GN=UBI3 PE=2 SV=2 77 152 8.0E-44
sp|P62981|RS27A_SOLTU Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum GN=UBI3 PE=2 SV=2 153 228 8.0E-44
sp|P62981|RS27A_SOLTU Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum GN=UBI3 PE=2 SV=2 229 304 8.0E-44
sp|P62980|RS27A_SOLLC Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum GN=UBI3 PE=3 SV=2 1 76 8.0E-44
sp|P62980|RS27A_SOLLC Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum GN=UBI3 PE=3 SV=2 77 152 8.0E-44
sp|P62980|RS27A_SOLLC Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum GN=UBI3 PE=3 SV=2 153 228 8.0E-44
sp|P62980|RS27A_SOLLC Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum GN=UBI3 PE=3 SV=2 229 304 8.0E-44
sp|P49633|RL40_ACACA Ubiquitin-60S ribosomal protein L40 OS=Acanthamoeba castellanii PE=2 SV=2 1 77 8.0E-44
sp|P49633|RL40_ACACA Ubiquitin-60S ribosomal protein L40 OS=Acanthamoeba castellanii PE=2 SV=2 77 153 8.0E-44
sp|P49633|RL40_ACACA Ubiquitin-60S ribosomal protein L40 OS=Acanthamoeba castellanii PE=2 SV=2 153 229 8.0E-44
sp|P0C276|RL40_SHEEP Ubiquitin-60S ribosomal protein L40 OS=Ovis aries GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P0C276|RL40_SHEEP Ubiquitin-60S ribosomal protein L40 OS=Ovis aries GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P0C276|RL40_SHEEP Ubiquitin-60S ribosomal protein L40 OS=Ovis aries GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P62986|RL40_RAT Ubiquitin-60S ribosomal protein L40 OS=Rattus norvegicus GN=Uba52 PE=1 SV=2 1 77 8.0E-44
sp|P62986|RL40_RAT Ubiquitin-60S ribosomal protein L40 OS=Rattus norvegicus GN=Uba52 PE=1 SV=2 77 153 8.0E-44
sp|P62986|RL40_RAT Ubiquitin-60S ribosomal protein L40 OS=Rattus norvegicus GN=Uba52 PE=1 SV=2 153 229 8.0E-44
sp|P0C275|RL40_PONPY Ubiquitin-60S ribosomal protein L40 OS=Pongo pygmaeus GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P0C275|RL40_PONPY Ubiquitin-60S ribosomal protein L40 OS=Pongo pygmaeus GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P0C275|RL40_PONPY Ubiquitin-60S ribosomal protein L40 OS=Pongo pygmaeus GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P63053|RL40_PIG Ubiquitin-60S ribosomal protein L40 OS=Sus scrofa GN=UBA52 PE=1 SV=2 1 77 8.0E-44
sp|P63053|RL40_PIG Ubiquitin-60S ribosomal protein L40 OS=Sus scrofa GN=UBA52 PE=1 SV=2 77 153 8.0E-44
sp|P63053|RL40_PIG Ubiquitin-60S ribosomal protein L40 OS=Sus scrofa GN=UBA52 PE=1 SV=2 153 229 8.0E-44
sp|P68205|RL40_OPHHA Ubiquitin-60S ribosomal protein L40 OS=Ophiophagus hannah PE=2 SV=2 1 77 8.0E-44
sp|P68205|RL40_OPHHA Ubiquitin-60S ribosomal protein L40 OS=Ophiophagus hannah PE=2 SV=2 77 153 8.0E-44
sp|P68205|RL40_OPHHA Ubiquitin-60S ribosomal protein L40 OS=Ophiophagus hannah PE=2 SV=2 153 229 8.0E-44
sp|P62984|RL40_MOUSE Ubiquitin-60S ribosomal protein L40 OS=Mus musculus GN=Uba52 PE=1 SV=2 1 77 8.0E-44
sp|P62984|RL40_MOUSE Ubiquitin-60S ribosomal protein L40 OS=Mus musculus GN=Uba52 PE=1 SV=2 77 153 8.0E-44
sp|P62984|RL40_MOUSE Ubiquitin-60S ribosomal protein L40 OS=Mus musculus GN=Uba52 PE=1 SV=2 153 229 8.0E-44
sp|P0C273|RL40_MACFA Ubiquitin-60S ribosomal protein L40 OS=Macaca fascicularis GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P0C273|RL40_MACFA Ubiquitin-60S ribosomal protein L40 OS=Macaca fascicularis GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P0C273|RL40_MACFA Ubiquitin-60S ribosomal protein L40 OS=Macaca fascicularis GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P62987|RL40_HUMAN Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 1 77 8.0E-44
sp|P62987|RL40_HUMAN Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 77 153 8.0E-44
sp|P62987|RL40_HUMAN Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 153 229 8.0E-44
sp|P63052|RL40_FELCA Ubiquitin-60S ribosomal protein L40 OS=Felis catus GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P63052|RL40_FELCA Ubiquitin-60S ribosomal protein L40 OS=Felis catus GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P63052|RL40_FELCA Ubiquitin-60S ribosomal protein L40 OS=Felis catus GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P63050|RL40_CANLF Ubiquitin-60S ribosomal protein L40 OS=Canis lupus familiaris GN=UBA52 PE=2 SV=2 1 77 8.0E-44
sp|P63050|RL40_CANLF Ubiquitin-60S ribosomal protein L40 OS=Canis lupus familiaris GN=UBA52 PE=2 SV=2 77 153 8.0E-44
sp|P63050|RL40_CANLF Ubiquitin-60S ribosomal protein L40 OS=Canis lupus familiaris GN=UBA52 PE=2 SV=2 153 229 8.0E-44
sp|P63048|RL40_BOVIN Ubiquitin-60S ribosomal protein L40 OS=Bos taurus GN=UBA52 PE=1 SV=2 1 77 8.0E-44
sp|P63048|RL40_BOVIN Ubiquitin-60S ribosomal protein L40 OS=Bos taurus GN=UBA52 PE=1 SV=2 77 153 8.0E-44
sp|P63048|RL40_BOVIN Ubiquitin-60S ribosomal protein L40 OS=Bos taurus GN=UBA52 PE=1 SV=2 153 229 8.0E-44
sp|P18101|RL40_DROME Ubiquitin-60S ribosomal protein L40 OS=Drosophila melanogaster GN=RpL40 PE=1 SV=2 1 77 9.0E-44
sp|P18101|RL40_DROME Ubiquitin-60S ribosomal protein L40 OS=Drosophila melanogaster GN=RpL40 PE=1 SV=2 77 153 9.0E-44
sp|P18101|RL40_DROME Ubiquitin-60S ribosomal protein L40 OS=Drosophila melanogaster GN=RpL40 PE=1 SV=2 153 229 9.0E-44
sp|P49633|RL40_ACACA Ubiquitin-60S ribosomal protein L40 OS=Acanthamoeba castellanii PE=2 SV=2 229 304 1.0E-43
sp|P0C276|RL40_SHEEP Ubiquitin-60S ribosomal protein L40 OS=Ovis aries GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P62986|RL40_RAT Ubiquitin-60S ribosomal protein L40 OS=Rattus norvegicus GN=Uba52 PE=1 SV=2 229 304 1.0E-43
sp|P0C275|RL40_PONPY Ubiquitin-60S ribosomal protein L40 OS=Pongo pygmaeus GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P63053|RL40_PIG Ubiquitin-60S ribosomal protein L40 OS=Sus scrofa GN=UBA52 PE=1 SV=2 229 304 1.0E-43
sp|P68205|RL40_OPHHA Ubiquitin-60S ribosomal protein L40 OS=Ophiophagus hannah PE=2 SV=2 229 304 1.0E-43
sp|P62984|RL40_MOUSE Ubiquitin-60S ribosomal protein L40 OS=Mus musculus GN=Uba52 PE=1 SV=2 229 304 1.0E-43
sp|P0C273|RL40_MACFA Ubiquitin-60S ribosomal protein L40 OS=Macaca fascicularis GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P62987|RL40_HUMAN Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 229 304 1.0E-43
sp|P63052|RL40_FELCA Ubiquitin-60S ribosomal protein L40 OS=Felis catus GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P63050|RL40_CANLF Ubiquitin-60S ribosomal protein L40 OS=Canis lupus familiaris GN=UBA52 PE=2 SV=2 229 304 1.0E-43
sp|P63048|RL40_BOVIN Ubiquitin-60S ribosomal protein L40 OS=Bos taurus GN=UBA52 PE=1 SV=2 229 304 1.0E-43
sp|P18101|RL40_DROME Ubiquitin-60S ribosomal protein L40 OS=Drosophila melanogaster GN=RpL40 PE=1 SV=2 229 304 1.0E-43
sp|P0DJ25|RL40_TETTS Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena thermophila (strain SB210) GN=RPL40 PE=1 SV=1 1 87 1.0E-43
sp|P0DJ25|RL40_TETTS Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena thermophila (strain SB210) GN=RPL40 PE=1 SV=1 77 163 1.0E-43
sp|P0DJ25|RL40_TETTS Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena thermophila (strain SB210) GN=RPL40 PE=1 SV=1 153 239 1.0E-43
sp|P33190|RL40_TETPY Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena pyriformis GN=TUF11 PE=3 SV=2 1 87 1.0E-43
sp|P33190|RL40_TETPY Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena pyriformis GN=TUF11 PE=3 SV=2 77 163 1.0E-43
sp|P33190|RL40_TETPY Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena pyriformis GN=TUF11 PE=3 SV=2 153 239 1.0E-43
sp|P0DJ25|RL40_TETTS Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena thermophila (strain SB210) GN=RPL40 PE=1 SV=1 229 304 2.0E-43
sp|P33190|RL40_TETPY Ubiquitin-60S ribosomal protein L40 OS=Tetrahymena pyriformis GN=TUF11 PE=3 SV=2 229 304 2.0E-43
sp|P46575|RL40_EIMBO Ubiquitin-60S ribosomal protein L40 OS=Eimeria bovis PE=2 SV=2 1 77 3.0E-43
sp|P46575|RL40_EIMBO Ubiquitin-60S ribosomal protein L40 OS=Eimeria bovis PE=2 SV=2 77 153 3.0E-43
sp|P46575|RL40_EIMBO Ubiquitin-60S ribosomal protein L40 OS=Eimeria bovis PE=2 SV=2 153 229 3.0E-43
sp|P14794|RL40_DICDI Ubiquitin-60S ribosomal protein L40 OS=Dictyostelium discoideum GN=ubqB PE=1 SV=2 1 78 3.0E-43
sp|P14794|RL40_DICDI Ubiquitin-60S ribosomal protein L40 OS=Dictyostelium discoideum GN=ubqB PE=1 SV=2 77 154 3.0E-43
sp|P14794|RL40_DICDI Ubiquitin-60S ribosomal protein L40 OS=Dictyostelium discoideum GN=ubqB PE=1 SV=2 153 230 3.0E-43
sp|P62975|UBIQ_RABIT Ubiquitin OS=Oryctolagus cuniculus PE=1 SV=1 1 76 3.0E-43
sp|P62975|UBIQ_RABIT Ubiquitin OS=Oryctolagus cuniculus PE=1 SV=1 77 152 3.0E-43
sp|P62975|UBIQ_RABIT Ubiquitin OS=Oryctolagus cuniculus PE=1 SV=1 153 228 3.0E-43
sp|P62975|UBIQ_RABIT Ubiquitin OS=Oryctolagus cuniculus PE=1 SV=1 229 304 3.0E-43
sp|P68197|UBIQ_CERCA Ubiquitin OS=Ceratitis capitata PE=1 SV=1 1 76 3.0E-43
sp|P68197|UBIQ_CERCA Ubiquitin OS=Ceratitis capitata PE=1 SV=1 77 152 3.0E-43
sp|P68197|UBIQ_CERCA Ubiquitin OS=Ceratitis capitata PE=1 SV=1 153 228 3.0E-43
sp|P68197|UBIQ_CERCA Ubiquitin OS=Ceratitis capitata PE=1 SV=1 229 304 3.0E-43
sp|Q865C5|UBIQ_CAMDR Ubiquitin OS=Camelus dromedarius PE=3 SV=2 1 76 3.0E-43
sp|Q865C5|UBIQ_CAMDR Ubiquitin OS=Camelus dromedarius PE=3 SV=2 77 152 3.0E-43
sp|Q865C5|UBIQ_CAMDR Ubiquitin OS=Camelus dromedarius PE=3 SV=2 153 228 3.0E-43
sp|Q865C5|UBIQ_CAMDR Ubiquitin OS=Camelus dromedarius PE=3 SV=2 229 304 3.0E-43
sp|P46575|RL40_EIMBO Ubiquitin-60S ribosomal protein L40 OS=Eimeria bovis PE=2 SV=2 229 304 4.0E-43
sp|P69201|RL40_LEIMA Ubiquitin-60S ribosomal protein L40 OS=Leishmania major GN=UB-EP52 PE=3 SV=2 1 77 4.0E-43
sp|P69201|RL40_LEIMA Ubiquitin-60S ribosomal protein L40 OS=Leishmania major GN=UB-EP52 PE=3 SV=2 77 153 4.0E-43
sp|P69201|RL40_LEIMA Ubiquitin-60S ribosomal protein L40 OS=Leishmania major GN=UB-EP52 PE=3 SV=2 153 229 4.0E-43
sp|P21899|RL40_TRYBB Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma brucei brucei PE=1 SV=2 1 77 5.0E-43
sp|P21899|RL40_TRYBB Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma brucei brucei PE=1 SV=2 77 153 5.0E-43
sp|P21899|RL40_TRYBB Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma brucei brucei PE=1 SV=2 153 229 5.0E-43
sp|P79781|RS27A_CHICK Ubiquitin-40S ribosomal protein S27a OS=Gallus gallus GN=RPS27A PE=2 SV=3 1 76 5.0E-43
sp|P79781|RS27A_CHICK Ubiquitin-40S ribosomal protein S27a OS=Gallus gallus GN=RPS27A PE=2 SV=3 77 152 5.0E-43
sp|P79781|RS27A_CHICK Ubiquitin-40S ribosomal protein S27a OS=Gallus gallus GN=RPS27A PE=2 SV=3 153 228 5.0E-43
sp|P79781|RS27A_CHICK Ubiquitin-40S ribosomal protein S27a OS=Gallus gallus GN=RPS27A PE=2 SV=3 229 304 5.0E-43
sp|P69201|RL40_LEIMA Ubiquitin-60S ribosomal protein L40 OS=Leishmania major GN=UB-EP52 PE=3 SV=2 229 304 6.0E-43
sp|P21899|RL40_TRYBB Ubiquitin-60S ribosomal protein L40 OS=Trypanosoma brucei brucei PE=1 SV=2 229 304 6.0E-43
sp|P62979|RS27A_HUMAN Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 1 76 6.0E-43
sp|P62979|RS27A_HUMAN Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 77 152 6.0E-43
sp|P62979|RS27A_HUMAN Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 153 228 6.0E-43
sp|P62979|RS27A_HUMAN Ubiquitin-40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV=2 229 304 6.0E-43
sp|P62978|RS27A_CAVPO Ubiquitin-40S ribosomal protein S27a OS=Cavia porcellus GN=RPS27A PE=1 SV=2 1 76 6.0E-43
sp|P62978|RS27A_CAVPO Ubiquitin-40S ribosomal protein S27a OS=Cavia porcellus GN=RPS27A PE=1 SV=2 77 152 6.0E-43
sp|P62978|RS27A_CAVPO Ubiquitin-40S ribosomal protein S27a OS=Cavia porcellus GN=RPS27A PE=1 SV=2 153 228 6.0E-43
sp|P62978|RS27A_CAVPO Ubiquitin-40S ribosomal protein S27a OS=Cavia porcellus GN=RPS27A PE=1 SV=2 229 304 6.0E-43
sp|P62992|RS27A_BOVIN Ubiquitin-40S ribosomal protein S27a OS=Bos taurus GN=RPS27A PE=1 SV=2 1 76 6.0E-43
sp|P62992|RS27A_BOVIN Ubiquitin-40S ribosomal protein S27a OS=Bos taurus GN=RPS27A PE=1 SV=2 77 152 6.0E-43
sp|P62992|RS27A_BOVIN Ubiquitin-40S ribosomal protein S27a OS=Bos taurus GN=RPS27A PE=1 SV=2 153 228 6.0E-43
sp|P62992|RS27A_BOVIN Ubiquitin-40S ribosomal protein S27a OS=Bos taurus GN=RPS27A PE=1 SV=2 229 304 6.0E-43
sp|P68200|RS27A_ICTPU Ubiquitin-40S ribosomal protein S27a OS=Ictalurus punctatus GN=rps27a PE=2 SV=2 1 76 6.0E-43
sp|P68200|RS27A_ICTPU Ubiquitin-40S ribosomal protein S27a OS=Ictalurus punctatus GN=rps27a PE=2 SV=2 77 152 6.0E-43
sp|P68200|RS27A_ICTPU Ubiquitin-40S ribosomal protein S27a OS=Ictalurus punctatus GN=rps27a PE=2 SV=2 153 228 6.0E-43
sp|P68200|RS27A_ICTPU Ubiquitin-40S ribosomal protein S27a OS=Ictalurus punctatus GN=rps27a PE=2 SV=2 229 304 6.0E-43
sp|P14794|RL40_DICDI Ubiquitin-60S ribosomal protein L40 OS=Dictyostelium discoideum GN=ubqB PE=1 SV=2 229 304 7.0E-43
sp|P62982|RS27A_RAT Ubiquitin-40S ribosomal protein S27a OS=Rattus norvegicus GN=Rps27a PE=1 SV=2 1 76 7.0E-43
sp|P62982|RS27A_RAT Ubiquitin-40S ribosomal protein S27a OS=Rattus norvegicus GN=Rps27a PE=1 SV=2 77 152 7.0E-43
sp|P62982|RS27A_RAT Ubiquitin-40S ribosomal protein S27a OS=Rattus norvegicus GN=Rps27a PE=1 SV=2 153 228 7.0E-43
sp|P62982|RS27A_RAT Ubiquitin-40S ribosomal protein S27a OS=Rattus norvegicus GN=Rps27a PE=1 SV=2 229 304 7.0E-43
sp|P62983|RS27A_MOUSE Ubiquitin-40S ribosomal protein S27a OS=Mus musculus GN=Rps27a PE=1 SV=2 1 76 7.0E-43
sp|P62983|RS27A_MOUSE Ubiquitin-40S ribosomal protein S27a OS=Mus musculus GN=Rps27a PE=1 SV=2 77 152 7.0E-43
sp|P62983|RS27A_MOUSE Ubiquitin-40S ribosomal protein S27a OS=Mus musculus GN=Rps27a PE=1 SV=2 153 228 7.0E-43
sp|P62983|RS27A_MOUSE Ubiquitin-40S ribosomal protein S27a OS=Mus musculus GN=Rps27a PE=1 SV=2 229 304 7.0E-43
sp|P15357|RS27A_DROME Ubiquitin-40S ribosomal protein S27a OS=Drosophila melanogaster GN=RpS27A PE=1 SV=2 1 76 7.0E-43
sp|P15357|RS27A_DROME Ubiquitin-40S ribosomal protein S27a OS=Drosophila melanogaster GN=RpS27A PE=1 SV=2 77 152 7.0E-43
sp|P15357|RS27A_DROME Ubiquitin-40S ribosomal protein S27a OS=Drosophila melanogaster GN=RpS27A PE=1 SV=2 153 228 7.0E-43
sp|P15357|RS27A_DROME Ubiquitin-40S ribosomal protein S27a OS=Drosophila melanogaster GN=RpS27A PE=1 SV=2 229 304 7.0E-43
sp|Q8SWD4|UBIQ_ENCCU Ubiquitin OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU02_0740i PE=1 SV=1 1 76 9.0E-43
sp|Q8SWD4|UBIQ_ENCCU Ubiquitin OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU02_0740i PE=1 SV=1 77 152 9.0E-43
sp|Q8SWD4|UBIQ_ENCCU Ubiquitin OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU02_0740i PE=1 SV=1 153 228 9.0E-43
sp|Q8SWD4|UBIQ_ENCCU Ubiquitin OS=Encephalitozoon cuniculi (strain GB-M1) GN=ECU02_0740i PE=1 SV=1 229 304 9.0E-43
sp|P68202|RS27A_PLUXY Ubiquitin-40S ribosomal protein S27a OS=Plutella xylostella PE=2 SV=2 1 76 1.0E-42
sp|P68202|RS27A_PLUXY Ubiquitin-40S ribosomal protein S27a OS=Plutella xylostella PE=2 SV=2 77 152 1.0E-42
sp|P68202|RS27A_PLUXY Ubiquitin-40S ribosomal protein S27a OS=Plutella xylostella PE=2 SV=2 153 228 1.0E-42
sp|P68202|RS27A_PLUXY Ubiquitin-40S ribosomal protein S27a OS=Plutella xylostella PE=2 SV=2 229 304 1.0E-42
sp|P29504|RS27A_MANSE Ubiquitin-40S ribosomal protein S27a OS=Manduca sexta PE=2 SV=2 1 76 1.0E-42
sp|P29504|RS27A_MANSE Ubiquitin-40S ribosomal protein S27a OS=Manduca sexta PE=2 SV=2 77 152 1.0E-42
sp|P29504|RS27A_MANSE Ubiquitin-40S ribosomal protein S27a OS=Manduca sexta PE=2 SV=2 153 228 1.0E-42
sp|P29504|RS27A_MANSE Ubiquitin-40S ribosomal protein S27a OS=Manduca sexta PE=2 SV=2 229 304 1.0E-42
sp|P68203|RS27A_SPOFR Ubiquitin-40S ribosomal protein S27a OS=Spodoptera frugiperda PE=2 SV=2 1 76 1.0E-42
sp|P68203|RS27A_SPOFR Ubiquitin-40S ribosomal protein S27a OS=Spodoptera frugiperda PE=2 SV=2 77 152 1.0E-42
sp|P68203|RS27A_SPOFR Ubiquitin-40S ribosomal protein S27a OS=Spodoptera frugiperda PE=2 SV=2 153 228 1.0E-42
sp|P68203|RS27A_SPOFR Ubiquitin-40S ribosomal protein S27a OS=Spodoptera frugiperda PE=2 SV=2 229 304 1.0E-42
sp|P23398|UBIQP_STRPU Polyubiquitin (Fragment) OS=Strongylocentrotus purpuratus PE=2 SV=2 1 76 6.0E-42
sp|P59272|RS27A_DAUCA Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Daucus carota PE=2 SV=2 1 73 3.0E-41
sp|P59272|RS27A_DAUCA Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Daucus carota PE=2 SV=2 77 149 3.0E-41
sp|P59272|RS27A_DAUCA Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Daucus carota PE=2 SV=2 153 225 3.0E-41
sp|P59272|RS27A_DAUCA Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Daucus carota PE=2 SV=2 229 301 3.0E-41
sp|P69200|RL40_LEITA Ubiquitin-60S ribosomal protein L40 OS=Leishmania tarentolae GN=UB-EP52 PE=3 SV=2 1 77 6.0E-41
sp|P69200|RL40_LEITA Ubiquitin-60S ribosomal protein L40 OS=Leishmania tarentolae GN=UB-EP52 PE=3 SV=2 77 153 6.0E-41
sp|P69200|RL40_LEITA Ubiquitin-60S ribosomal protein L40 OS=Leishmania tarentolae GN=UB-EP52 PE=3 SV=2 153 229 6.0E-41
sp|P69200|RL40_LEITA Ubiquitin-60S ribosomal protein L40 OS=Leishmania tarentolae GN=UB-EP52 PE=3 SV=2 229 304 8.0E-41
sp|P0C8R3|RS27B_SCHPO Ubiquitin-40S ribosomal protein S27b OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi5 PE=1 SV=2 1 71 1.0E-40
sp|P0C8R3|RS27B_SCHPO Ubiquitin-40S ribosomal protein S27b OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi5 PE=1 SV=2 77 147 1.0E-40
sp|P0C8R3|RS27B_SCHPO Ubiquitin-40S ribosomal protein S27b OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi5 PE=1 SV=2 153 223 1.0E-40
sp|P0C8R3|RS27B_SCHPO Ubiquitin-40S ribosomal protein S27b OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi5 PE=1 SV=2 229 299 1.0E-40
sp|P0C016|RS27A_SCHPO Ubiquitin-40S ribosomal protein S27a OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi3 PE=1 SV=2 1 71 1.0E-40
sp|P0C016|RS27A_SCHPO Ubiquitin-40S ribosomal protein S27a OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi3 PE=1 SV=2 77 147 1.0E-40
sp|P0C016|RS27A_SCHPO Ubiquitin-40S ribosomal protein S27a OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi3 PE=1 SV=2 153 223 1.0E-40
sp|P0C016|RS27A_SCHPO Ubiquitin-40S ribosomal protein S27a OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubi3 PE=1 SV=2 229 299 1.0E-40
sp|P14797|RS27A_DICDI Ubiquitin-40S ribosomal protein S27a OS=Dictyostelium discoideum GN=ubqC PE=1 SV=2 1 74 1.0E-40
sp|P14797|RS27A_DICDI Ubiquitin-40S ribosomal protein S27a OS=Dictyostelium discoideum GN=ubqC PE=1 SV=2 77 150 1.0E-40
sp|P14797|RS27A_DICDI Ubiquitin-40S ribosomal protein S27a OS=Dictyostelium discoideum GN=ubqC PE=1 SV=2 153 226 1.0E-40
sp|P14797|RS27A_DICDI Ubiquitin-40S ribosomal protein S27a OS=Dictyostelium discoideum GN=ubqC PE=1 SV=2 229 302 1.0E-40
sp|P05759|RS27A_YEAST Ubiquitin-40S ribosomal protein S31 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS31 PE=1 SV=3 1 70 3.0E-40
sp|P05759|RS27A_YEAST Ubiquitin-40S ribosomal protein S31 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS31 PE=1 SV=3 77 146 3.0E-40
sp|P05759|RS27A_YEAST Ubiquitin-40S ribosomal protein S31 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS31 PE=1 SV=3 153 222 3.0E-40
sp|P05759|RS27A_YEAST Ubiquitin-40S ribosomal protein S31 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPS31 PE=1 SV=3 229 298 3.0E-40
sp|P69061|RS27A_KLULA Ubiquitin-40S ribosomal protein S27a OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi3 PE=1 SV=2 1 70 7.0E-40
sp|P69061|RS27A_KLULA Ubiquitin-40S ribosomal protein S27a OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi3 PE=1 SV=2 77 146 7.0E-40
sp|P69061|RS27A_KLULA Ubiquitin-40S ribosomal protein S27a OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi3 PE=1 SV=2 153 222 7.0E-40
sp|P69061|RS27A_KLULA Ubiquitin-40S ribosomal protein S27a OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=ubi3 PE=1 SV=2 229 298 7.0E-40
sp|P14799|RS27A_NEUCR Ubiquitin-40S ribosomal protein S27a OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi::crp-6 PE=1 SV=4 1 70 3.0E-39
sp|P14799|RS27A_NEUCR Ubiquitin-40S ribosomal protein S27a OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi::crp-6 PE=1 SV=4 77 146 3.0E-39
sp|P14799|RS27A_NEUCR Ubiquitin-40S ribosomal protein S27a OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi::crp-6 PE=1 SV=4 153 222 3.0E-39
sp|P14799|RS27A_NEUCR Ubiquitin-40S ribosomal protein S27a OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) GN=ubi::crp-6 PE=1 SV=4 229 298 3.0E-39
sp|Q05120|UBIL_NPVOP Ubiquitin-like protein OS=Orgyia pseudotsugata multicapsid polyhedrosis virus GN=V-UBI PE=3 SV=1 1 76 2.0E-34
sp|Q05120|UBIL_NPVOP Ubiquitin-like protein OS=Orgyia pseudotsugata multicapsid polyhedrosis virus GN=V-UBI PE=3 SV=1 77 152 2.0E-34
sp|Q05120|UBIL_NPVOP Ubiquitin-like protein OS=Orgyia pseudotsugata multicapsid polyhedrosis virus GN=V-UBI PE=3 SV=1 153 228 2.0E-34
sp|Q05120|UBIL_NPVOP Ubiquitin-like protein OS=Orgyia pseudotsugata multicapsid polyhedrosis virus GN=V-UBI PE=3 SV=1 229 304 2.0E-34
sp|P16709|UBIL_NPVAC Ubiquitin-like protein OS=Autographa californica nuclear polyhedrosis virus GN=V-UBI PE=3 SV=2 1 76 5.0E-34
sp|P16709|UBIL_NPVAC Ubiquitin-like protein OS=Autographa californica nuclear polyhedrosis virus GN=V-UBI PE=3 SV=2 77 152 5.0E-34
sp|P16709|UBIL_NPVAC Ubiquitin-like protein OS=Autographa californica nuclear polyhedrosis virus GN=V-UBI PE=3 SV=2 153 228 5.0E-34
sp|P16709|UBIL_NPVAC Ubiquitin-like protein OS=Autographa californica nuclear polyhedrosis virus GN=V-UBI PE=3 SV=2 229 304 5.0E-34
sp|P84589|UBIQ_LUMTE Ubiquitin (Fragment) OS=Lumbricus terrestris PE=1 SV=2 12 74 1.0E-33
sp|P84589|UBIQ_LUMTE Ubiquitin (Fragment) OS=Lumbricus terrestris PE=1 SV=2 88 150 1.0E-33
sp|P84589|UBIQ_LUMTE Ubiquitin (Fragment) OS=Lumbricus terrestris PE=1 SV=2 164 226 1.0E-33
sp|P84589|UBIQ_LUMTE Ubiquitin (Fragment) OS=Lumbricus terrestris PE=1 SV=2 240 302 1.0E-33
sp|Q9VJ33|NEDD8_DROME NEDD8 OS=Drosophila melanogaster GN=Nedd8 PE=1 SV=1 1 84 6.0E-24
sp|Q9VJ33|NEDD8_DROME NEDD8 OS=Drosophila melanogaster GN=Nedd8 PE=1 SV=1 77 160 6.0E-24
sp|Q9VJ33|NEDD8_DROME NEDD8 OS=Drosophila melanogaster GN=Nedd8 PE=1 SV=1 153 236 6.0E-24
sp|Q9VJ33|NEDD8_DROME NEDD8 OS=Drosophila melanogaster GN=Nedd8 PE=1 SV=1 229 304 1.0E-23
sp|Q93725|NEDD8_CAEEL NEDD8 OS=Caenorhabditis elegans GN=ned-8 PE=1 SV=1 1 77 2.0E-23
sp|Q93725|NEDD8_CAEEL NEDD8 OS=Caenorhabditis elegans GN=ned-8 PE=1 SV=1 77 153 2.0E-23
sp|Q93725|NEDD8_CAEEL NEDD8 OS=Caenorhabditis elegans GN=ned-8 PE=1 SV=1 153 229 2.0E-23
sp|Q93725|NEDD8_CAEEL NEDD8 OS=Caenorhabditis elegans GN=ned-8 PE=1 SV=1 229 304 3.0E-23
sp|Q4PLJ0|NEDD8_RABIT NEDD8 OS=Oryctolagus cuniculus GN=NEDD8 PE=3 SV=1 1 76 8.0E-22
sp|Q4PLJ0|NEDD8_RABIT NEDD8 OS=Oryctolagus cuniculus GN=NEDD8 PE=3 SV=1 77 152 8.0E-22
sp|Q4PLJ0|NEDD8_RABIT NEDD8 OS=Oryctolagus cuniculus GN=NEDD8 PE=3 SV=1 153 228 8.0E-22
sp|Q4PLJ0|NEDD8_RABIT NEDD8 OS=Oryctolagus cuniculus GN=NEDD8 PE=3 SV=1 229 304 8.0E-22
sp|Q15843|NEDD8_HUMAN NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 1 76 8.0E-22
sp|Q15843|NEDD8_HUMAN NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 77 152 8.0E-22
sp|Q15843|NEDD8_HUMAN NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 153 228 8.0E-22
sp|Q15843|NEDD8_HUMAN NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 229 304 8.0E-22
sp|P61282|NEDD8_BOVIN NEDD8 OS=Bos taurus GN=NEDD8 PE=3 SV=1 1 76 8.0E-22
sp|P61282|NEDD8_BOVIN NEDD8 OS=Bos taurus GN=NEDD8 PE=3 SV=1 77 152 8.0E-22
sp|P61282|NEDD8_BOVIN NEDD8 OS=Bos taurus GN=NEDD8 PE=3 SV=1 153 228 8.0E-22
sp|P61282|NEDD8_BOVIN NEDD8 OS=Bos taurus GN=NEDD8 PE=3 SV=1 229 304 8.0E-22
sp|O65381|RUB3_ARATH NEDD8-like protein RUB3 OS=Arabidopsis thaliana GN=RUB3 PE=2 SV=1 1 77 2.0E-21
sp|O65381|RUB3_ARATH NEDD8-like protein RUB3 OS=Arabidopsis thaliana GN=RUB3 PE=2 SV=1 77 153 2.0E-21
sp|O65381|RUB3_ARATH NEDD8-like protein RUB3 OS=Arabidopsis thaliana GN=RUB3 PE=2 SV=1 153 229 2.0E-21
sp|Q54XV3|NEDD8_DICDI NEDD8 OS=Dictyostelium discoideum GN=nedd8 PE=3 SV=2 1 77 2.0E-21
sp|Q54XV3|NEDD8_DICDI NEDD8 OS=Dictyostelium discoideum GN=nedd8 PE=3 SV=2 77 153 2.0E-21
sp|Q54XV3|NEDD8_DICDI NEDD8 OS=Dictyostelium discoideum GN=nedd8 PE=3 SV=2 153 229 2.0E-21
sp|O65381|RUB3_ARATH NEDD8-like protein RUB3 OS=Arabidopsis thaliana GN=RUB3 PE=2 SV=1 229 304 3.0E-21
sp|Q54XV3|NEDD8_DICDI NEDD8 OS=Dictyostelium discoideum GN=nedd8 PE=3 SV=2 229 304 5.0E-21
sp|O14399|UBL1_SCHPO Ubiquitin-like protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubl1 PE=3 SV=1 1 76 7.0E-21
sp|O14399|UBL1_SCHPO Ubiquitin-like protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubl1 PE=3 SV=1 77 152 7.0E-21
sp|O14399|UBL1_SCHPO Ubiquitin-like protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubl1 PE=3 SV=1 153 228 7.0E-21
sp|O14399|UBL1_SCHPO Ubiquitin-like protein 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=ubl1 PE=3 SV=1 229 304 7.0E-21
sp|P31753|RS27A_ASPOF Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Asparagus officinalis PE=2 SV=2 37 76 2.0E-19
sp|P31753|RS27A_ASPOF Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Asparagus officinalis PE=2 SV=2 113 152 2.0E-19
sp|P31753|RS27A_ASPOF Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Asparagus officinalis PE=2 SV=2 189 228 2.0E-19
sp|P31753|RS27A_ASPOF Ubiquitin-40S ribosomal protein S27a (Fragment) OS=Asparagus officinalis PE=2 SV=2 265 304 2.0E-19
sp|Q03919|RUB1_YEAST NEDD8-like protein RUB1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RUB1 PE=1 SV=1 1 76 1.0E-18
sp|Q03919|RUB1_YEAST NEDD8-like protein RUB1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RUB1 PE=1 SV=1 77 152 1.0E-18
sp|Q03919|RUB1_YEAST NEDD8-like protein RUB1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RUB1 PE=1 SV=1 153 228 1.0E-18
sp|Q03919|RUB1_YEAST NEDD8-like protein RUB1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RUB1 PE=1 SV=1 229 304 1.0E-18
sp|Q9ZPY9|P4KG4_ARATH Phosphatidylinositol 4-kinase gamma 4 OS=Arabidopsis thaliana GN=PI4KG4 PE=1 SV=1 7 148 5.0E-18
sp|Q9ZPY9|P4KG4_ARATH Phosphatidylinositol 4-kinase gamma 4 OS=Arabidopsis thaliana GN=PI4KG4 PE=1 SV=1 159 300 5.0E-18
sp|Q64339|ISG15_MOUSE Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15 PE=1 SV=4 5 152 2.0E-17
sp|Q64339|ISG15_MOUSE Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15 PE=1 SV=4 81 228 2.0E-17
sp|Q64339|ISG15_MOUSE Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15 PE=1 SV=4 157 304 2.0E-17
sp|Q71UE8|NEDD8_RAT NEDD8 OS=Rattus norvegicus GN=Nedd8 PE=1 SV=1 1 68 4.0E-17
sp|Q71UE8|NEDD8_RAT NEDD8 OS=Rattus norvegicus GN=Nedd8 PE=1 SV=1 77 144 4.0E-17
sp|Q71UE8|NEDD8_RAT NEDD8 OS=Rattus norvegicus GN=Nedd8 PE=1 SV=1 153 220 4.0E-17
sp|Q71UE8|NEDD8_RAT NEDD8 OS=Rattus norvegicus GN=Nedd8 PE=1 SV=1 229 296 4.0E-17
sp|P29595|NEDD8_MOUSE NEDD8 OS=Mus musculus GN=Nedd8 PE=1 SV=2 1 68 4.0E-17
sp|P29595|NEDD8_MOUSE NEDD8 OS=Mus musculus GN=Nedd8 PE=1 SV=2 77 144 4.0E-17
sp|P29595|NEDD8_MOUSE NEDD8 OS=Mus musculus GN=Nedd8 PE=1 SV=2 153 220 4.0E-17
sp|P29595|NEDD8_MOUSE NEDD8 OS=Mus musculus GN=Nedd8 PE=1 SV=2 229 296 4.0E-17
sp|O15205|UBD_HUMAN Ubiquitin D OS=Homo sapiens GN=UBD PE=1 SV=2 1 152 3.0E-16
sp|O15205|UBD_HUMAN Ubiquitin D OS=Homo sapiens GN=UBD PE=1 SV=2 77 228 3.0E-16
sp|O15205|UBD_HUMAN Ubiquitin D OS=Homo sapiens GN=UBD PE=1 SV=2 153 304 3.0E-16
sp|D3Z3C6|ZFAN4_MOUSE AN1-type zinc finger protein 4 OS=Mus musculus GN=Zfand4 PE=3 SV=2 59 152 1.0E-13
sp|D3Z3C6|ZFAN4_MOUSE AN1-type zinc finger protein 4 OS=Mus musculus GN=Zfand4 PE=3 SV=2 135 228 1.0E-13
sp|D3Z3C6|ZFAN4_MOUSE AN1-type zinc finger protein 4 OS=Mus musculus GN=Zfand4 PE=3 SV=2 211 304 1.0E-13
sp|D3Z3C6|ZFAN4_MOUSE AN1-type zinc finger protein 4 OS=Mus musculus GN=Zfand4 PE=3 SV=2 1 76 2.0E-13
sp|Q921A3|UBD_RAT Ubiquitin D OS=Rattus norvegicus GN=Ubd PE=1 SV=1 3 152 3.0E-13
sp|Q921A3|UBD_RAT Ubiquitin D OS=Rattus norvegicus GN=Ubd PE=1 SV=1 79 228 3.0E-13
sp|Q921A3|UBD_RAT Ubiquitin D OS=Rattus norvegicus GN=Ubd PE=1 SV=1 155 304 3.0E-13
sp|Q9SGW8|P4KG2_ARATH Phosphatidylinositol 4-kinase gamma 2 OS=Arabidopsis thaliana GN=PI4KG2 PE=1 SV=2 7 148 9.0E-13
sp|Q9SGW8|P4KG2_ARATH Phosphatidylinositol 4-kinase gamma 2 OS=Arabidopsis thaliana GN=PI4KG2 PE=1 SV=2 83 224 9.0E-13
sp|Q9SGW8|P4KG2_ARATH Phosphatidylinositol 4-kinase gamma 2 OS=Arabidopsis thaliana GN=PI4KG2 PE=1 SV=2 159 300 9.0E-13
sp|Q86XD8|ZFAN4_HUMAN AN1-type zinc finger protein 4 OS=Homo sapiens GN=ZFAND4 PE=2 SV=2 59 152 1.0E-12
sp|Q86XD8|ZFAN4_HUMAN AN1-type zinc finger protein 4 OS=Homo sapiens GN=ZFAND4 PE=2 SV=2 135 228 1.0E-12
sp|Q86XD8|ZFAN4_HUMAN AN1-type zinc finger protein 4 OS=Homo sapiens GN=ZFAND4 PE=2 SV=2 211 304 1.0E-12
sp|Q86XD8|ZFAN4_HUMAN AN1-type zinc finger protein 4 OS=Homo sapiens GN=ZFAND4 PE=2 SV=2 1 76 1.0E-12
sp|Q9FNF8|P4KG3_ARATH Phosphatidylinositol 4-kinase gamma 3 OS=Arabidopsis thaliana GN=PI4KG3 PE=2 SV=1 7 147 1.0E-12
sp|Q9FNF8|P4KG3_ARATH Phosphatidylinositol 4-kinase gamma 3 OS=Arabidopsis thaliana GN=PI4KG3 PE=2 SV=1 83 223 1.0E-12
sp|Q9FNF8|P4KG3_ARATH Phosphatidylinositol 4-kinase gamma 3 OS=Arabidopsis thaliana GN=PI4KG3 PE=2 SV=1 159 299 1.0E-12
sp|O02741|ISG15_BOVIN Ubiquitin-like protein ISG15 OS=Bos taurus GN=ISG15 PE=2 SV=3 5 152 1.0E-12
sp|O02741|ISG15_BOVIN Ubiquitin-like protein ISG15 OS=Bos taurus GN=ISG15 PE=2 SV=3 81 228 1.0E-12
sp|O02741|ISG15_BOVIN Ubiquitin-like protein ISG15 OS=Bos taurus GN=ISG15 PE=2 SV=3 157 304 1.0E-12
sp|P37164|RS27A_CAEBR Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis briggsae GN=ubl-1 PE=1 SV=2 3 78 3.0E-12
sp|P37164|RS27A_CAEBR Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis briggsae GN=ubl-1 PE=1 SV=2 79 154 3.0E-12
sp|P37164|RS27A_CAEBR Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis briggsae GN=ubl-1 PE=1 SV=2 155 230 3.0E-12
sp|P37164|RS27A_CAEBR Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis briggsae GN=ubl-1 PE=1 SV=2 231 304 4.0E-12
sp|P37165|RS27A_CAEEL Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis elegans GN=ubl-1 PE=1 SV=2 3 78 6.0E-12
sp|P37165|RS27A_CAEEL Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis elegans GN=ubl-1 PE=1 SV=2 79 154 6.0E-12
sp|P37165|RS27A_CAEEL Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis elegans GN=ubl-1 PE=1 SV=2 155 230 6.0E-12
sp|P63072|UBD_MOUSE Ubiquitin D OS=Mus musculus GN=Ubd PE=1 SV=1 3 152 6.0E-12
sp|P63072|UBD_MOUSE Ubiquitin D OS=Mus musculus GN=Ubd PE=1 SV=1 79 228 6.0E-12
sp|P63072|UBD_MOUSE Ubiquitin D OS=Mus musculus GN=Ubd PE=1 SV=1 155 304 6.0E-12
sp|P37165|RS27A_CAEEL Ubiquitin-like protein 1-40S ribosomal protein S27a OS=Caenorhabditis elegans GN=ubl-1 PE=1 SV=2 231 304 7.0E-12
sp|P05161|ISG15_HUMAN Ubiquitin-like protein ISG15 OS=Homo sapiens GN=ISG15 PE=1 SV=5 76 228 8.0E-12
sp|P05161|ISG15_HUMAN Ubiquitin-like protein ISG15 OS=Homo sapiens GN=ISG15 PE=1 SV=5 152 304 8.0E-12
sp|P05161|ISG15_HUMAN Ubiquitin-like protein ISG15 OS=Homo sapiens GN=ISG15 PE=1 SV=5 5 152 3.0E-11
sp|B2GV38|UBL4A_RAT Ubiquitin-like protein 4A OS=Rattus norvegicus GN=Ubl4a PE=2 SV=1 1 72 5.0E-11
sp|B2GV38|UBL4A_RAT Ubiquitin-like protein 4A OS=Rattus norvegicus GN=Ubl4a PE=2 SV=1 77 148 5.0E-11
sp|B2GV38|UBL4A_RAT Ubiquitin-like protein 4A OS=Rattus norvegicus GN=Ubl4a PE=2 SV=1 153 224 5.0E-11
sp|B2GV38|UBL4A_RAT Ubiquitin-like protein 4A OS=Rattus norvegicus GN=Ubl4a PE=2 SV=1 229 300 5.0E-11
sp|P21126|UBL4A_MOUSE Ubiquitin-like protein 4A OS=Mus musculus GN=Ubl4a PE=1 SV=1 1 72 6.0E-11
sp|P21126|UBL4A_MOUSE Ubiquitin-like protein 4A OS=Mus musculus GN=Ubl4a PE=1 SV=1 77 148 6.0E-11
sp|P21126|UBL4A_MOUSE Ubiquitin-like protein 4A OS=Mus musculus GN=Ubl4a PE=1 SV=1 153 224 6.0E-11
sp|P21126|UBL4A_MOUSE Ubiquitin-like protein 4A OS=Mus musculus GN=Ubl4a PE=1 SV=1 229 300 6.0E-11
sp|B2KIK3|UBL4A_RHIFE Ubiquitin-like protein 4A OS=Rhinolophus ferrumequinum GN=UBL4A PE=3 SV=1 1 72 8.0E-11
sp|B2KIK3|UBL4A_RHIFE Ubiquitin-like protein 4A OS=Rhinolophus ferrumequinum GN=UBL4A PE=3 SV=1 77 148 8.0E-11
sp|B2KIK3|UBL4A_RHIFE Ubiquitin-like protein 4A OS=Rhinolophus ferrumequinum GN=UBL4A PE=3 SV=1 153 224 8.0E-11
sp|B2KIK3|UBL4A_RHIFE Ubiquitin-like protein 4A OS=Rhinolophus ferrumequinum GN=UBL4A PE=3 SV=1 229 300 8.0E-11
sp|C1BXU5|UBL4A_ESOLU Ubiquitin-like protein 4A OS=Esox lucius GN=ubl4a PE=2 SV=1 1 75 9.0E-11
sp|C1BXU5|UBL4A_ESOLU Ubiquitin-like protein 4A OS=Esox lucius GN=ubl4a PE=2 SV=1 77 151 9.0E-11
sp|C1BXU5|UBL4A_ESOLU Ubiquitin-like protein 4A OS=Esox lucius GN=ubl4a PE=2 SV=1 153 227 9.0E-11
sp|C1BXU5|UBL4A_ESOLU Ubiquitin-like protein 4A OS=Esox lucius GN=ubl4a PE=2 SV=1 229 303 9.0E-11
sp|B1MTV8|UBL4A_CALMO Ubiquitin-like protein 4A OS=Callicebus moloch GN=UBL4A PE=3 SV=1 1 72 1.0E-10
sp|B1MTV8|UBL4A_CALMO Ubiquitin-like protein 4A OS=Callicebus moloch GN=UBL4A PE=3 SV=1 77 148 1.0E-10
sp|B1MTV8|UBL4A_CALMO Ubiquitin-like protein 4A OS=Callicebus moloch GN=UBL4A PE=3 SV=1 153 224 1.0E-10
sp|B1MTV8|UBL4A_CALMO Ubiquitin-like protein 4A OS=Callicebus moloch GN=UBL4A PE=3 SV=1 229 300 1.0E-10
sp|P11441|UBL4A_HUMAN Ubiquitin-like protein 4A OS=Homo sapiens GN=UBL4A PE=1 SV=1 1 72 1.0E-10
sp|P11441|UBL4A_HUMAN Ubiquitin-like protein 4A OS=Homo sapiens GN=UBL4A PE=1 SV=1 77 148 1.0E-10
sp|P11441|UBL4A_HUMAN Ubiquitin-like protein 4A OS=Homo sapiens GN=UBL4A PE=1 SV=1 153 224 1.0E-10
sp|P11441|UBL4A_HUMAN Ubiquitin-like protein 4A OS=Homo sapiens GN=UBL4A PE=1 SV=1 229 300 1.0E-10
sp|Q5R4T1|UBL4A_PONAB Ubiquitin-like protein 4A OS=Pongo abelii GN=UBL4A PE=2 SV=1 1 72 1.0E-10
sp|Q5R4T1|UBL4A_PONAB Ubiquitin-like protein 4A OS=Pongo abelii GN=UBL4A PE=2 SV=1 77 148 1.0E-10
sp|Q5R4T1|UBL4A_PONAB Ubiquitin-like protein 4A OS=Pongo abelii GN=UBL4A PE=2 SV=1 153 224 1.0E-10
sp|Q5R4T1|UBL4A_PONAB Ubiquitin-like protein 4A OS=Pongo abelii GN=UBL4A PE=2 SV=1 229 300 1.0E-10
sp|B0KWT6|UBL4A_CALJA Ubiquitin-like protein 4A OS=Callithrix jacchus GN=UBL4A PE=3 SV=1 1 72 1.0E-10
sp|B0KWT6|UBL4A_CALJA Ubiquitin-like protein 4A OS=Callithrix jacchus GN=UBL4A PE=3 SV=1 77 148 1.0E-10
sp|B0KWT6|UBL4A_CALJA Ubiquitin-like protein 4A OS=Callithrix jacchus GN=UBL4A PE=3 SV=1 153 224 1.0E-10
sp|B0KWT6|UBL4A_CALJA Ubiquitin-like protein 4A OS=Callithrix jacchus GN=UBL4A PE=3 SV=1 229 300 1.0E-10
sp|B7NZQ9|UBL4A_RABIT Ubiquitin-like protein 4A OS=Oryctolagus cuniculus GN=UBL4A PE=3 SV=1 1 72 2.0E-10
sp|B7NZQ9|UBL4A_RABIT Ubiquitin-like protein 4A OS=Oryctolagus cuniculus GN=UBL4A PE=3 SV=1 77 148 2.0E-10
sp|B7NZQ9|UBL4A_RABIT Ubiquitin-like protein 4A OS=Oryctolagus cuniculus GN=UBL4A PE=3 SV=1 153 224 2.0E-10
sp|B7NZQ9|UBL4A_RABIT Ubiquitin-like protein 4A OS=Oryctolagus cuniculus GN=UBL4A PE=3 SV=1 229 300 2.0E-10
sp|Q15646|OASL_HUMAN 2'-5'-oligoadenylate synthase-like protein OS=Homo sapiens GN=OASL PE=1 SV=2 56 232 6.0E-10
sp|Q15646|OASL_HUMAN 2'-5'-oligoadenylate synthase-like protein OS=Homo sapiens GN=OASL PE=1 SV=2 132 297 7.0E-10
sp|Q7ZWB2|UBL4A_DANRE Ubiquitin-like protein 4A OS=Danio rerio GN=ubl4a PE=2 SV=1 1 75 2.0E-09
sp|Q7ZWB2|UBL4A_DANRE Ubiquitin-like protein 4A OS=Danio rerio GN=ubl4a PE=2 SV=1 77 151 2.0E-09
sp|Q7ZWB2|UBL4A_DANRE Ubiquitin-like protein 4A OS=Danio rerio GN=ubl4a PE=2 SV=1 153 227 2.0E-09
sp|Q7ZWB2|UBL4A_DANRE Ubiquitin-like protein 4A OS=Danio rerio GN=ubl4a PE=2 SV=1 229 303 2.0E-09
sp|B5XFI8|UB4AA_SALSA Ubiquitin-like protein 4A-A OS=Salmo salar GN=ubl4aa PE=2 SV=1 1 75 2.0E-09
sp|B5XFI8|UB4AA_SALSA Ubiquitin-like protein 4A-A OS=Salmo salar GN=ubl4aa PE=2 SV=1 77 151 2.0E-09
sp|B5XFI8|UB4AA_SALSA Ubiquitin-like protein 4A-A OS=Salmo salar GN=ubl4aa PE=2 SV=1 153 227 2.0E-09
sp|B5XFI8|UB4AA_SALSA Ubiquitin-like protein 4A-A OS=Salmo salar GN=ubl4aa PE=2 SV=1 229 303 2.0E-09
sp|Q9SU29|UPL5_ARATH E3 ubiquitin-protein ligase UPL5 OS=Arabidopsis thaliana GN=UPL5 PE=1 SV=1 229 305 2.0E-09
sp|Q9SU29|UPL5_ARATH E3 ubiquitin-protein ligase UPL5 OS=Arabidopsis thaliana GN=UPL5 PE=1 SV=1 1 75 2.0E-09
sp|Q9SU29|UPL5_ARATH E3 ubiquitin-protein ligase UPL5 OS=Arabidopsis thaliana GN=UPL5 PE=1 SV=1 77 151 2.0E-09
sp|Q9SU29|UPL5_ARATH E3 ubiquitin-protein ligase UPL5 OS=Arabidopsis thaliana GN=UPL5 PE=1 SV=1 153 227 2.0E-09
sp|C3KHF2|UBL4A_ANOFI Ubiquitin-like protein 4A OS=Anoplopoma fimbria GN=ubl4a PE=2 SV=1 1 75 2.0E-09
sp|C3KHF2|UBL4A_ANOFI Ubiquitin-like protein 4A OS=Anoplopoma fimbria GN=ubl4a PE=2 SV=1 77 151 2.0E-09
sp|C3KHF2|UBL4A_ANOFI Ubiquitin-like protein 4A OS=Anoplopoma fimbria GN=ubl4a PE=2 SV=1 153 227 2.0E-09
sp|C3KHF2|UBL4A_ANOFI Ubiquitin-like protein 4A OS=Anoplopoma fimbria GN=ubl4a PE=2 SV=1 229 303 2.0E-09
sp|C1BGZ8|UB4AA_ONCMY Ubiquitin-like protein 4A-A OS=Oncorhynchus mykiss GN=ubl4aa PE=2 SV=1 1 75 3.0E-09
sp|C1BGZ8|UB4AA_ONCMY Ubiquitin-like protein 4A-A OS=Oncorhynchus mykiss GN=ubl4aa PE=2 SV=1 77 151 3.0E-09
sp|C1BGZ8|UB4AA_ONCMY Ubiquitin-like protein 4A-A OS=Oncorhynchus mykiss GN=ubl4aa PE=2 SV=1 153 227 3.0E-09
sp|C1BGZ8|UB4AA_ONCMY Ubiquitin-like protein 4A-A OS=Oncorhynchus mykiss GN=ubl4aa PE=2 SV=1 229 303 3.0E-09
sp|B5X9S9|UB4AB_SALSA Ubiquitin-like protein 4A-B OS=Salmo salar GN=ubl4ab PE=2 SV=1 1 75 5.0E-09
sp|B5X9S9|UB4AB_SALSA Ubiquitin-like protein 4A-B OS=Salmo salar GN=ubl4ab PE=2 SV=1 77 151 5.0E-09
sp|B5X9S9|UB4AB_SALSA Ubiquitin-like protein 4A-B OS=Salmo salar GN=ubl4ab PE=2 SV=1 153 227 5.0E-09
sp|B5X9S9|UB4AB_SALSA Ubiquitin-like protein 4A-B OS=Salmo salar GN=ubl4ab PE=2 SV=1 229 303 5.0E-09
sp|C1BHN7|UB4AB_ONCMY Ubiquitin-like protein 4A-B OS=Oncorhynchus mykiss GN=ubl4ab PE=2 SV=1 1 75 7.0E-09
sp|C1BHN7|UB4AB_ONCMY Ubiquitin-like protein 4A-B OS=Oncorhynchus mykiss GN=ubl4ab PE=2 SV=1 77 151 7.0E-09
sp|C1BHN7|UB4AB_ONCMY Ubiquitin-like protein 4A-B OS=Oncorhynchus mykiss GN=ubl4ab PE=2 SV=1 153 227 7.0E-09
sp|C1BHN7|UB4AB_ONCMY Ubiquitin-like protein 4A-B OS=Oncorhynchus mykiss GN=ubl4ab PE=2 SV=1 229 303 7.0E-09
sp|Q0D261|UBL4A_XENLA Ubiquitin-like protein 4A OS=Xenopus laevis GN=ubl4a PE=2 SV=1 1 72 8.0E-09
sp|Q0D261|UBL4A_XENLA Ubiquitin-like protein 4A OS=Xenopus laevis GN=ubl4a PE=2 SV=1 77 148 8.0E-09
sp|Q0D261|UBL4A_XENLA Ubiquitin-like protein 4A OS=Xenopus laevis GN=ubl4a PE=2 SV=1 153 224 8.0E-09
sp|Q0D261|UBL4A_XENLA Ubiquitin-like protein 4A OS=Xenopus laevis GN=ubl4a PE=2 SV=1 229 300 8.0E-09
sp|A4QND0|UBL4A_XENTR Ubiquitin-like protein 4A OS=Xenopus tropicalis GN=ubl4a PE=2 SV=1 1 72 8.0E-09
sp|A4QND0|UBL4A_XENTR Ubiquitin-like protein 4A OS=Xenopus tropicalis GN=ubl4a PE=2 SV=1 77 148 8.0E-09
sp|A4QND0|UBL4A_XENTR Ubiquitin-like protein 4A OS=Xenopus tropicalis GN=ubl4a PE=2 SV=1 153 224 8.0E-09
sp|A4QND0|UBL4A_XENTR Ubiquitin-like protein 4A OS=Xenopus tropicalis GN=ubl4a PE=2 SV=1 229 300 8.0E-09
sp|Q15646|OASL_HUMAN 2'-5'-oligoadenylate synthase-like protein OS=Homo sapiens GN=OASL PE=1 SV=2 13 156 6.0E-08
sp|Q8VI94|OASL1_MOUSE 2'-5'-oligoadenylate synthase-like protein 1 OS=Mus musculus GN=Oasl1 PE=2 SV=1 1 143 6.0E-08
sp|Q8VI94|OASL1_MOUSE 2'-5'-oligoadenylate synthase-like protein 1 OS=Mus musculus GN=Oasl1 PE=2 SV=1 77 219 6.0E-08
sp|Q8VI94|OASL1_MOUSE 2'-5'-oligoadenylate synthase-like protein 1 OS=Mus musculus GN=Oasl1 PE=2 SV=1 153 295 6.0E-08
sp|O60260|PRKN2_HUMAN E3 ubiquitin-protein ligase parkin OS=Homo sapiens GN=PARK2 PE=1 SV=2 229 305 4.0E-07
sp|Q9WVS6|PRKN2_MOUSE E3 ubiquitin-protein ligase parkin OS=Mus musculus GN=Park2 PE=1 SV=1 1 74 4.0E-07
sp|Q9WVS6|PRKN2_MOUSE E3 ubiquitin-protein ligase parkin OS=Mus musculus GN=Park2 PE=1 SV=1 77 150 4.0E-07
sp|Q9WVS6|PRKN2_MOUSE E3 ubiquitin-protein ligase parkin OS=Mus musculus GN=Park2 PE=1 SV=1 153 226 4.0E-07
sp|Q9WVS6|PRKN2_MOUSE E3 ubiquitin-protein ligase parkin OS=Mus musculus GN=Park2 PE=1 SV=1 229 302 4.0E-07
sp|P05161|ISG15_HUMAN Ubiquitin-like protein ISG15 OS=Homo sapiens GN=ISG15 PE=1 SV=5 1 76 5.0E-07
sp|Q9JK66|PRKN2_RAT E3 ubiquitin-protein ligase parkin OS=Rattus norvegicus GN=Park2 PE=1 SV=1 1 72 5.0E-07
sp|Q9JK66|PRKN2_RAT E3 ubiquitin-protein ligase parkin OS=Rattus norvegicus GN=Park2 PE=1 SV=1 77 148 5.0E-07
sp|Q9JK66|PRKN2_RAT E3 ubiquitin-protein ligase parkin OS=Rattus norvegicus GN=Park2 PE=1 SV=1 153 224 5.0E-07
sp|Q9JK66|PRKN2_RAT E3 ubiquitin-protein ligase parkin OS=Rattus norvegicus GN=Park2 PE=1 SV=1 229 300 5.0E-07
sp|O60260|PRKN2_HUMAN E3 ubiquitin-protein ligase parkin OS=Homo sapiens GN=PARK2 PE=1 SV=2 1 79 8.0E-07
sp|O60260|PRKN2_HUMAN E3 ubiquitin-protein ligase parkin OS=Homo sapiens GN=PARK2 PE=1 SV=2 77 155 8.0E-07
sp|O60260|PRKN2_HUMAN E3 ubiquitin-protein ligase parkin OS=Homo sapiens GN=PARK2 PE=1 SV=2 153 231 8.0E-07
sp|Q9YHD3|BAG6A_XENLA Large proline-rich protein bag6-A OS=Xenopus laevis GN=Bag6-a PE=2 SV=1 1 72 8.0E-07
sp|Q9YHD3|BAG6A_XENLA Large proline-rich protein bag6-A OS=Xenopus laevis GN=Bag6-a PE=2 SV=1 77 148 8.0E-07
sp|Q9YHD3|BAG6A_XENLA Large proline-rich protein bag6-A OS=Xenopus laevis GN=Bag6-a PE=2 SV=1 153 224 8.0E-07
sp|Q9YHD3|BAG6A_XENLA Large proline-rich protein bag6-A OS=Xenopus laevis GN=Bag6-a PE=2 SV=1 229 300 8.0E-07
sp|Q19KS6|UBL4B_MONDO Ubiquitin-like protein 4B OS=Monodelphis domestica GN=UBL4B PE=2 SV=1 1 72 9.0E-07
sp|Q19KS6|UBL4B_MONDO Ubiquitin-like protein 4B OS=Monodelphis domestica GN=UBL4B PE=2 SV=1 77 148 9.0E-07
sp|Q19KS6|UBL4B_MONDO Ubiquitin-like protein 4B OS=Monodelphis domestica GN=UBL4B PE=2 SV=1 153 224 9.0E-07
sp|Q19KS6|UBL4B_MONDO Ubiquitin-like protein 4B OS=Monodelphis domestica GN=UBL4B PE=2 SV=1 229 300 9.0E-07
sp|A7X5R6|BAG6_ORNAN Large proline-rich protein BAG6 OS=Ornithorhynchus anatinus GN=BAG6 PE=3 SV=1 1 72 1.0E-06
sp|A7X5R6|BAG6_ORNAN Large proline-rich protein BAG6 OS=Ornithorhynchus anatinus GN=BAG6 PE=3 SV=1 77 148 1.0E-06
sp|A7X5R6|BAG6_ORNAN Large proline-rich protein BAG6 OS=Ornithorhynchus anatinus GN=BAG6 PE=3 SV=1 153 224 1.0E-06
sp|A7X5R6|BAG6_ORNAN Large proline-rich protein BAG6 OS=Ornithorhynchus anatinus GN=BAG6 PE=3 SV=1 229 300 1.0E-06
sp|A4IH17|BAG6_XENTR Large proline-rich protein bag6 OS=Xenopus tropicalis GN=Bag6 PE=2 SV=1 1 72 1.0E-06
sp|A4IH17|BAG6_XENTR Large proline-rich protein bag6 OS=Xenopus tropicalis GN=Bag6 PE=2 SV=1 77 148 1.0E-06
sp|A4IH17|BAG6_XENTR Large proline-rich protein bag6 OS=Xenopus tropicalis GN=Bag6 PE=2 SV=1 153 224 1.0E-06
sp|A4IH17|BAG6_XENTR Large proline-rich protein bag6 OS=Xenopus tropicalis GN=Bag6 PE=2 SV=1 229 300 1.0E-06
sp|P62865|UBIM_BOVIN Ubiquitin-like protein FUBI OS=Bos taurus GN=FAU PE=3 SV=1 1 76 2.0E-06
sp|P62865|UBIM_BOVIN Ubiquitin-like protein FUBI OS=Bos taurus GN=FAU PE=3 SV=1 77 152 2.0E-06
sp|P62865|UBIM_BOVIN Ubiquitin-like protein FUBI OS=Bos taurus GN=FAU PE=3 SV=1 153 228 2.0E-06
sp|P62865|UBIM_BOVIN Ubiquitin-like protein FUBI OS=Bos taurus GN=FAU PE=3 SV=1 229 304 2.0E-06
sp|A7E320|UHRF1_BOVIN E3 ubiquitin-protein ligase UHRF1 OS=Bos taurus GN=UHRF1 PE=2 SV=1 1 98 2.0E-06
sp|A7E320|UHRF1_BOVIN E3 ubiquitin-protein ligase UHRF1 OS=Bos taurus GN=UHRF1 PE=2 SV=1 77 174 2.0E-06
sp|A7E320|UHRF1_BOVIN E3 ubiquitin-protein ligase UHRF1 OS=Bos taurus GN=UHRF1 PE=2 SV=1 153 250 2.0E-06
sp|P0C2F1|UBIM_PONAB Ubiquitin-like protein FUBI OS=Pongo abelii GN=FAU PE=3 SV=1 1 76 3.0E-06
sp|P0C2F1|UBIM_PONAB Ubiquitin-like protein FUBI OS=Pongo abelii GN=FAU PE=3 SV=1 77 152 3.0E-06
sp|P0C2F1|UBIM_PONAB Ubiquitin-like protein FUBI OS=Pongo abelii GN=FAU PE=3 SV=1 153 228 3.0E-06
sp|P0C2F1|UBIM_PONAB Ubiquitin-like protein FUBI OS=Pongo abelii GN=FAU PE=3 SV=1 229 304 3.0E-06
sp|Q6PA26|BAG6B_XENLA Large proline-rich protein bag6-B OS=Xenopus laevis GN=Bag6-b PE=2 SV=1 1 72 4.0E-06
sp|Q6PA26|BAG6B_XENLA Large proline-rich protein bag6-B OS=Xenopus laevis GN=Bag6-b PE=2 SV=1 77 148 4.0E-06
sp|Q6PA26|BAG6B_XENLA Large proline-rich protein bag6-B OS=Xenopus laevis GN=Bag6-b PE=2 SV=1 153 224 4.0E-06
sp|Q6PA26|BAG6B_XENLA Large proline-rich protein bag6-B OS=Xenopus laevis GN=Bag6-b PE=2 SV=1 229 300 4.0E-06
sp|O02741|ISG15_BOVIN Ubiquitin-like protein ISG15 OS=Bos taurus GN=ISG15 PE=2 SV=3 3 76 5.0E-06
sp|Q64339|ISG15_MOUSE Ubiquitin-like protein ISG15 OS=Mus musculus GN=Isg15 PE=1 SV=4 1 76 6.0E-06
sp|Q2T9Q2|UBL4B_BOVIN Ubiquitin-like protein 4B OS=Bos taurus GN=UBL4B PE=2 SV=1 1 72 8.0E-06
sp|Q2T9Q2|UBL4B_BOVIN Ubiquitin-like protein 4B OS=Bos taurus GN=UBL4B PE=2 SV=1 77 148 8.0E-06
sp|Q2T9Q2|UBL4B_BOVIN Ubiquitin-like protein 4B OS=Bos taurus GN=UBL4B PE=2 SV=1 153 224 8.0E-06
sp|Q2T9Q2|UBL4B_BOVIN Ubiquitin-like protein 4B OS=Bos taurus GN=UBL4B PE=2 SV=1 229 300 8.0E-06
sp|Q05474|UBIM_RAT Ubiquitin-like protein FUBI OS=Rattus norvegicus GN=Fau PE=3 SV=1 1 76 1.0E-05
sp|Q05474|UBIM_RAT Ubiquitin-like protein FUBI OS=Rattus norvegicus GN=Fau PE=3 SV=1 77 152 1.0E-05
sp|Q05474|UBIM_RAT Ubiquitin-like protein FUBI OS=Rattus norvegicus GN=Fau PE=3 SV=1 153 228 1.0E-05
sp|Q05474|UBIM_RAT Ubiquitin-like protein FUBI OS=Rattus norvegicus GN=Fau PE=3 SV=1 229 304 1.0E-05
[Show less]

GO

GO Term Description Terminal node
GO:0005515 protein binding Yes
GO:0003674 molecular_function No
GO:0005488 binding No

Deeploc

[Help with interpreting the results of Deeploc 2.0]
Localizations Signals Cytoplasm Nucleus Extracellular Cell membrane Mitochondrion Plastid Endoplasmic reticulum Lysosome vacuole Golgi apparatus Peroxisome
Cytoplasm|Nucleus Nuclear localization signal|Nuclear export signal 0.7499 0.7533 0.3431 0.2498 0.0581 0.0005 0.0694 0.4386 0.0437 0.0156

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup4952
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|4935
Ophiocordyceps australis map64 (Brazil) OphauB2|948
Ophiocordyceps camponoti-floridani Ophcf2|01542
Ophiocordyceps camponoti-rufipedis Ophun1|6558
Ophiocordyceps kimflemingae Ophio5|4877
Ophiocordyceps subramaniannii Hirsu2|1910 (this protein)

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Hirsu2|1910
MQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRLRG
GMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRLR
GGMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLRL
RGGMQIFVKTLTGKTITLEVESSDTIDNVKSKIQDKEGIPPDQQRLIFAGKQLEDGRTLSDYNIQKESTLHLVLR
LRGGQ*
Coding >Hirsu2|1910
ATGCAGATCTTCGTCAAGACTCTCACGGGCAAGACCATCACCCTTGAGGTGGAGTCGTCCGATACCATCGACAAT
GTGAAGTCGAAGATTCAGGACAAGGAGGGCATTCCCCCCGATCAGCAGCGCCTGATCTTCGCCGGTAAACAACTC
GAGGATGGCCGGACCCTCTCCGACTACAACATTCAGAAGGAGTCGACCCTTCACCTCGTCCTCCGCCTTCGTGGT
GGCATGCAGATCTTCGTCAAGACCCTCACCGGAAAGACTATCACCCTCGAGGTGGAGTCCTCGGATACGATTGAC
AACGTCAAGTCGAAAATCCAGGACAAAGAGGGCATTCCCCCGGATCAGCAGCGCCTAATCTTCGCCGGCAAGCAA
CTCGAAGACGGCCGGACGCTCTCCGACTACAACATTCAGAAAGAGTCAACCCTGCACCTCGTCCTTCGTCTGCGT
GGCGGTATGCAGATTTTCGTCAAGACGTTGACGGGGAAAACCATCACCCTGGAAGTTGAATCCTCCGACACGATC
GACAACGTGAAATCGAAGATCCAGGACAAGGAAGGCATCCCCCCGGACCAGCAGCGACTCATCTTTGCCGGCAAG
CAGCTTGAGGACGGCCGCACCCTGAGTGACTACAACATTCAGAAGGAGAGCACTCTGCATCTCGTGTTACGTCTG
CGAGGTGGAATGCAGATTTTCGTCAAAACCCTGACCGGCAAGACCATCACGCTGGAAGTCGAATCTAGCGACACC
ATCGACAATGTCAAGTCCAAGATTCAAGATAAGGAGGGCATCCCTCCTGACCAGCAGCGACTGATTTTTGCCGGC
AAGCAGTTGGAGGATGGCCGCACCTTGAGCGACTATAACATCCAAAAGGAGAGCACTTTGCACCTGGTGCTGCGA
CTCCGTGGCGGCCAGTAG
Transcript >Hirsu2|1910
ATGCAGATCTTCGTCAAGACTCTCACGGGCAAGACCATCACCCTTGAGGTGGAGTCGTCCGATACCATCGACAAT
GTGAAGTCGAAGATTCAGGACAAGGAGGGCATTCCCCCCGATCAGCAGCGCCTGATCTTCGCCGGTAAACAACTC
GAGGATGGCCGGACCCTCTCCGACTACAACATTCAGAAGGAGTCGACCCTTCACCTCGTCCTCCGCCTTCGTGGT
GGCATGCAGATCTTCGTCAAGACCCTCACCGGAAAGACTATCACCCTCGAGGTGGAGTCCTCGGATACGATTGAC
AACGTCAAGTCGAAAATCCAGGACAAAGAGGGCATTCCCCCGGATCAGCAGCGCCTAATCTTCGCCGGCAAGCAA
CTCGAAGACGGCCGGACGCTCTCCGACTACAACATTCAGAAAGAGTCAACCCTGCACCTCGTCCTTCGTCTGCGT
GGCGGTATGCAGATTTTCGTCAAGACGTTGACGGGGAAAACCATCACCCTGGAAGTTGAATCCTCCGACACGATC
GACAACGTGAAATCGAAGATCCAGGACAAGGAAGGCATCCCCCCGGACCAGCAGCGACTCATCTTTGCCGGCAAG
CAGCTTGAGGACGGCCGCACCCTGAGTGACTACAACATTCAGAAGGAGAGCACTCTGCATCTCGTGTTACGTCTG
CGAGGTGGAATGCAGATTTTCGTCAAAACCCTGACCGGCAAGACCATCACGCTGGAAGTCGAATCTAGCGACACC
ATCGACAATGTCAAGTCCAAGATTCAAGATAAGGAGGGCATCCCTCCTGACCAGCAGCGACTGATTTTTGCCGGC
AAGCAGTTGGAGGATGGCCGCACCTTGAGCGACTATAACATCCAAAAGGAGAGCACTTTGCACCTGGTGCTGCGA
CTCCGTGGCGGCCAGTAG
Gene >Hirsu2|1910
ATGCAGATCTTCGTCAAGACTCGTGAGTCCCCCTCTCGTCGGCCACGGCGGCAAACATCTGCCATCGCTCCGCAA
CCGGATGCTGACCTCCGTCTTCTCTCGCAGTCACGGGCAAGACCATCACCCTTGAGGTGGAGTCGTCCGATACCA
TCGACAATGTGAAGTCGAAGATTCAGGACAAGGAGGGCATTCCCCCCGATCAGCAGCGCCTGATCTTCGCCGGTA
AACAACTCGAGGATGGCCGGACCCTCTCCGACTACAACATTCAGAAGGAGTCGACCCTTCACCTCGTCCTCCGCC
TTCGTGGTGGCATGCAGATCTGTATGTTCTCTATTCTCAGGCCACGTCGGTCCCGCCACATTCAGTCTACTGACC
ATATCTCGCAGTCGTCAAGACCCTCACCGGAAAGACTATCACCCTCGAGGTGGAGTCCTCGGATACGATTGACAA
CGTCAAGTCGAAAATCCAGGACAAAGAGGGCATTCCCCCGGATCAGCAGCGCCTAATCTTCGCCGGCAAGCAACT
CGAAGACGGCCGGACGCTCTCCGACTACAACATTCAGAAAGAGTCAACCCTGCACCTCGTCCTTCGTCTGCGTGG
CGGTATGCAGATTTTCGTCAAGACGTTGACGGGGAAAACCATCACCCTGGAAGTTGAATCCTCCGACACGATCGA
CAACGTGAAATCGAAGATCCAGGACAAGGAAGGCATCCCCCCGGACCAGCAGCGACTCATCTTTGCCGGCAAGCA
GCTTGAGGACGGCCGCACCCTGAGTGACTACAACATTCAGAAGGAGAGCACTCTGCATCTCGTGTTACGTCTGCG
AGGTGGAATGCAGATTTTCGTCAAAACCCTGACCGGCAAGACCATCACGCTGGAAGTCGAATCTAGCGACACCAT
CGACAATGTCAAGTCCAAGATTCAAGATAAGGAGGGCATCCCTCCTGACCAGCAGCGACTGATTTTTGCCGGCAA
GCAGTTGGAGGATGGCCGCACCTTGAGCGACTATAACATCCAAAAGGAGAGCACTTTGCACCTGGTGCTGCGACT
CCGTGGCGGCCAGTAG

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail