Fungal Genomics

at Utrecht University

General Properties

Protein IDHirsu2|1140
Gene name
LocationContig_124:28382..28976
Strand-
Gene length (bp)594
Transcript length (bp)315
Coding sequence length (bp)315
Protein length (aa) 105

Overview

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

Swissprot hits

(None)

GO

(None)

Deeploc

[Help with interpreting the results of Deeploc 2.0]
Localizations Signals Cytoplasm Nucleus Extracellular Cell membrane Mitochondrion Plastid Endoplasmic reticulum Lysosome vacuole Golgi apparatus Peroxisome
Cell membrane|Lysosome/Vacuole 0.4349 0.2608 0.0739 0.6675 0.167 0.0434 0.2773 0.6438 0.3789 0.0763

SignalP

(None)

Transmembrane Domains

(None)

Transcription Factor Class

(None)

CAZymes

(None)

Secondary Metabolism

(None)

Expression data

No expression data available for this genome

Orthologs

Orthofinder run ID4
Orthogroup1560
Change Orthofinder run
Species Protein ID
Ophiocordyceps australis 1348a (Ghana) OphauG2|5671
Ophiocordyceps australis map64 (Brazil) OphauB2|2406
Ophiocordyceps camponoti-floridani Ophcf2|00139
Ophiocordyceps camponoti-rufipedis Ophun1|3541
Ophiocordyceps kimflemingae Ophio5|3798
Ophiocordyceps subramaniannii Hirsu2|1140 (this protein)

Sequences

Type of sequenceSequence
Locus Download genbank file of locus Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >Hirsu2|1140
MSNQEYYGGGQGGYHQGGPGYPQQPQPSYGPPQGNYGPPQGNYNGGYQQGQPPMQYQQGPPPDDSRGRRGGSNNC
LMACIAALCCCCVAEEACECCIGCCECLL*
Coding >Hirsu2|1140
ATGTCCAACCAGGAGTACTACGGCGGTGGCCAGGGCGGCTATCACCAAGGAGGTCCCGGCTACCCTCAGCAGCCC
CAACCCAGCTATGGCCCTCCGCAAGGAAACTACGGCCCTCCCCAGGGCAACTACAACGGCGGTTATCAACAGGGC
CAGCCCCCCATGCAGTACCAACAGGGCCCTCCGCCCGACGACTCTCGCGGTCGCCGTGGCGGCAGCAACAACTGC
CTCATGGCCTGTATAGCCGCCTTGTGCTGCTGCTGCGTCGCCGAAGAGGCCTGCGAATGCTGCATTGGTTGCTGC
GAGTGCCTCCTCTAA
Transcript >Hirsu2|1140
ATGTCCAACCAGGAGTACTACGGCGGTGGCCAGGGCGGCTATCACCAAGGAGGTCCCGGCTACCCTCAGCAGCCC
CAACCCAGCTATGGCCCTCCGCAAGGAAACTACGGCCCTCCCCAGGGCAACTACAACGGCGGTTATCAACAGGGC
CAGCCCCCCATGCAGTACCAACAGGGCCCTCCGCCCGACGACTCTCGCGGTCGCCGTGGCGGCAGCAACAACTGC
CTCATGGCCTGTATAGCCGCCTTGTGCTGCTGCTGCGTCGCCGAAGAGGCCTGCGAATGCTGCATTGGTTGCTGC
GAGTGCCTCCTCTAA
Gene >Hirsu2|1140
ATGTCCAACCAGGAGTACTACGGCGGTGGCCAGGGCGGCTATCACCAAGGAGGTCCCGGCTACCCTCAGCAGCCC
CAACCCGTGAGCCAGCCCGCCCACGCCCGCGCCCATCTTCATCATCTCCGCCCATGATCATCTCCCCTCGAACGC
CCCCTCCACCAACGTCCTCCGTCCGCCGCCGTCGCGACAGGATGCGCTAACAAGATACCTCTGCCTCGAATAGAG
CTATGGCCCTCCGCAAGGAAACTACGGCCCTCCCCAGGGCAACTACAACGGCGGTTATCAACAGGGCCAGCCCCC
CATGCAGTACCAACAGGGCCCTCCGCCCGACGACTCTCGCGGTCGCCGTGGCGGCAGCAACAACTGCCTCATGGC
CTGTATAGCCGCCTTGTGCTGCTGCTGCGTCGCCGAAGAGGCCTGCGAATGCTGGTGCGTCAAGCCAAGCCGAGC
CTCGGCAGTCACCCCCCCTTCCCTTACTCCTTCTCCGAACCCGGCCGGAGACGACAGATGCCAGACGCGCGCCCG
CCTCTTCATACTTCGTCTGCTGACACTCATCCTGTGTACAGCATTGGTTGCTGCGAGTGCCTCCTCTAA

© 2023 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail