Protein ID | AgabiH97|077820 |
Gene name | |
Location | scaffold_4:2999149..2999661 |
Strand | - |
Gene length (bp) | 512 |
Transcript length (bp) | 345 |
Coding sequence length (bp) | 345 |
Protein length (aa) | 115 |
SignalP signal predicted | Location (based on Ymax) |
D score (significance: > 0.45) |
---|---|---|
Yes | 1 - 20 | 0.45 |
Expression values
Label | Description | Expression (RPKM) | Confidence interval (low) | Confidence interval (high) |
---|---|---|---|---|
Casing | Casing mycelium | 18.65 | 6.78 | 30.52 |
Initials | Initials knots | 1.80 | 0.00 | 3.90 |
Pileal_Stipeal_center | Stage I stipe center | 0.94 | 0.00 | 2.32 |
Pileal_Stipeal_shell | Stage I stipe shell | 0.00 | 0.00 | 0.00 |
DIF_stipe_center | Stage II stipe center | 0.00 | 0.00 | 0.00 |
DIF_stipe_shell | Stage II stipe shell | 1.00 | 0.00 | 2.48 |
DIF_stipe_skin | Stage II stipe skin | 0.23 | 0.00 | 0.65 |
DIF_cap_skin | Stage II cap skin | 0.15 | 0.00 | 0.45 |
DIF_cap_tissue | Stage II cap tissue | 0.31 | 0.00 | 0.72 |
DIF_gill_tissue | Stage II gill tissue | 0.29 | 0.00 | 0.71 |
YFB_stipe_center | Young fruiting body stipe center | 0.32 | 0.00 | 1.12 |
YFB_stipe_shell | Young fruiting body stipe shell | 0.35 | 0.00 | 1.15 |
YFB_stipe_skin | Young fruiting body stipe skin | 0.00 | 0.00 | 0.00 |
YFB_cap_skin | Young fruiting body cap skin | 0.00 | 0.00 | 0.00 |
YFB_cap_tissue | Young fruiting body cap tissue | 0.11 | 0.00 | 0.40 |
YFB_gill_tissue | Young fruiting body gill tissue | 0.30 | 0.00 | 1.09 |
YFB_veil | Young fruiting body veil | 0.00 | 0.00 | 0.00 |
Differential expression
Label1 | Label2 | Q-value | Significant difference |
---|---|---|---|
Casing | DIF_gill_tissue | 0.368389 | no |
Casing | YFB_stipe_center | 0.331349 | no |
Casing | YFB_stipe_shell | 0.309271 | no |
Casing | YFB_stipe_skin | 0.000613 | yes |
Casing | YFB_cap_skin | 0.000613 | yes |
Casing | YFB_cap_tissue | 0.494252 | no |
Casing | YFB_gill_tissue | 0.348798 | no |
Casing | YFB_veil | 0.000613 | yes |
Casing | Initials | 0.006032 | yes |
Casing | Pileal_Stipeal_center | 0.032038 | yes |
Casing | Pileal_Stipeal_shell | 0.000613 | yes |
Casing | DIF_stipe_center | 0.000613 | yes |
Casing | DIF_stipe_shell | 0.030610 | yes |
Casing | DIF_stipe_skin | 0.426345 | no |
Casing | DIF_cap_skin | 0.512033 | no |
Casing | DIF_cap_tissue | 0.359772 | no |
DIF_gill_tissue | YFB_stipe_center | 1.000000 | no |
DIF_gill_tissue | YFB_stipe_shell | 0.931990 | no |
DIF_gill_tissue | YFB_stipe_skin | 1.000000 | no |
DIF_gill_tissue | YFB_cap_skin | 1.000000 | no |
DIF_gill_tissue | YFB_cap_tissue | 1.000000 | no |
DIF_gill_tissue | YFB_gill_tissue | 1.000000 | no |
DIF_gill_tissue | YFB_veil | 1.000000 | no |
YFB_stipe_center | YFB_stipe_shell | 0.935311 | no |
YFB_stipe_center | YFB_stipe_skin | 1.000000 | no |
YFB_stipe_center | YFB_cap_skin | 1.000000 | no |
YFB_stipe_center | YFB_cap_tissue | 1.000000 | no |
YFB_stipe_center | YFB_gill_tissue | 1.000000 | no |
YFB_stipe_center | YFB_veil | 1.000000 | no |
YFB_stipe_shell | YFB_stipe_skin | 0.191454 | no |
YFB_stipe_shell | YFB_cap_skin | 0.191454 | no |
YFB_stipe_shell | YFB_cap_tissue | 0.694970 | no |
YFB_stipe_shell | YFB_gill_tissue | 0.932526 | no |
YFB_stipe_shell | YFB_veil | 0.191454 | no |
YFB_stipe_skin | YFB_cap_skin | 1.000000 | no |
YFB_stipe_skin | YFB_cap_tissue | 1.000000 | no |
YFB_stipe_skin | YFB_gill_tissue | 1.000000 | no |
YFB_stipe_skin | YFB_veil | 1.000000 | no |
YFB_cap_skin | YFB_cap_tissue | 1.000000 | no |
YFB_cap_skin | YFB_gill_tissue | 1.000000 | no |
YFB_cap_skin | YFB_veil | 1.000000 | no |
YFB_cap_tissue | YFB_gill_tissue | 1.000000 | no |
YFB_cap_tissue | YFB_veil | 1.000000 | no |
YFB_gill_tissue | YFB_veil | 1.000000 | no |
Initials | DIF_gill_tissue | 0.381187 | no |
Initials | YFB_stipe_center | 0.361281 | no |
Initials | YFB_stipe_shell | 0.346962 | no |
Initials | YFB_stipe_skin | 0.000613 | yes |
Initials | YFB_cap_skin | 0.000613 | yes |
Initials | YFB_cap_tissue | 0.494425 | no |
Initials | YFB_gill_tissue | 0.371318 | no |
Initials | YFB_veil | 0.000613 | yes |
Initials | Pileal_Stipeal_center | 0.596083 | no |
Initials | Pileal_Stipeal_shell | 0.000613 | yes |
Initials | DIF_stipe_center | 0.000613 | yes |
Initials | DIF_stipe_shell | 0.641529 | no |
Initials | DIF_stipe_skin | 0.429326 | no |
Initials | DIF_cap_skin | 0.512352 | no |
Initials | DIF_cap_tissue | 0.385853 | no |
Pileal_Stipeal_center | DIF_gill_tissue | 0.527988 | no |
Pileal_Stipeal_center | YFB_stipe_center | 0.584664 | no |
Pileal_Stipeal_center | YFB_stipe_shell | 0.586122 | no |
Pileal_Stipeal_center | YFB_stipe_skin | 0.016949 | yes |
Pileal_Stipeal_center | YFB_cap_skin | 0.016949 | yes |
Pileal_Stipeal_center | YFB_cap_tissue | 0.507422 | no |
Pileal_Stipeal_center | YFB_gill_tissue | 0.519590 | no |
Pileal_Stipeal_center | YFB_veil | 0.016949 | yes |
Pileal_Stipeal_center | Pileal_Stipeal_shell | 0.016949 | yes |
Pileal_Stipeal_center | DIF_stipe_center | 0.016949 | yes |
Pileal_Stipeal_center | DIF_stipe_shell | 0.968382 | no |
Pileal_Stipeal_center | DIF_stipe_skin | 0.493785 | no |
Pileal_Stipeal_center | DIF_cap_skin | 0.534672 | no |
Pileal_Stipeal_center | DIF_cap_tissue | 0.529214 | no |
Pileal_Stipeal_shell | DIF_gill_tissue | 1.000000 | no |
Pileal_Stipeal_shell | YFB_stipe_center | 1.000000 | no |
Pileal_Stipeal_shell | YFB_stipe_shell | 0.193015 | no |
Pileal_Stipeal_shell | YFB_stipe_skin | 1.000000 | no |
Pileal_Stipeal_shell | YFB_cap_skin | 1.000000 | no |
Pileal_Stipeal_shell | YFB_cap_tissue | 1.000000 | no |
Pileal_Stipeal_shell | YFB_gill_tissue | 1.000000 | no |
Pileal_Stipeal_shell | YFB_veil | 1.000000 | no |
Pileal_Stipeal_shell | DIF_stipe_center | 1.000000 | no |
Pileal_Stipeal_shell | DIF_stipe_shell | 0.018624 | yes |
Pileal_Stipeal_shell | DIF_stipe_skin | 1.000000 | no |
Pileal_Stipeal_shell | DIF_cap_skin | 1.000000 | no |
Pileal_Stipeal_shell | DIF_cap_tissue | 1.000000 | no |
DIF_stipe_center | DIF_gill_tissue | 1.000000 | no |
DIF_stipe_center | YFB_stipe_center | 1.000000 | no |
DIF_stipe_center | YFB_stipe_shell | 0.193015 | no |
DIF_stipe_center | YFB_stipe_skin | 1.000000 | no |
DIF_stipe_center | YFB_cap_skin | 1.000000 | no |
DIF_stipe_center | YFB_cap_tissue | 1.000000 | no |
DIF_stipe_center | YFB_gill_tissue | 1.000000 | no |
DIF_stipe_center | YFB_veil | 1.000000 | no |
DIF_stipe_center | DIF_stipe_shell | 0.018624 | yes |
DIF_stipe_center | DIF_stipe_skin | 1.000000 | no |
DIF_stipe_center | DIF_cap_skin | 1.000000 | no |
DIF_stipe_center | DIF_cap_tissue | 1.000000 | no |
DIF_stipe_shell | DIF_gill_tissue | 0.534672 | no |
DIF_stipe_shell | YFB_stipe_center | 0.530712 | no |
DIF_stipe_shell | YFB_stipe_shell | 0.596601 | no |
DIF_stipe_shell | YFB_stipe_skin | 0.014081 | yes |
DIF_stipe_shell | YFB_cap_skin | 0.014081 | yes |
DIF_stipe_shell | YFB_cap_tissue | 0.505957 | no |
DIF_stipe_shell | YFB_gill_tissue | 0.533104 | no |
DIF_stipe_shell | YFB_veil | 0.014081 | yes |
DIF_stipe_shell | DIF_stipe_skin | 0.500671 | no |
DIF_stipe_shell | DIF_cap_skin | 0.534722 | no |
DIF_stipe_shell | DIF_cap_tissue | 0.545481 | no |
DIF_stipe_skin | DIF_gill_tissue | 1.000000 | no |
DIF_stipe_skin | YFB_stipe_center | 1.000000 | no |
DIF_stipe_skin | YFB_stipe_shell | 0.869097 | no |
DIF_stipe_skin | YFB_stipe_skin | 1.000000 | no |
DIF_stipe_skin | YFB_cap_skin | 1.000000 | no |
DIF_stipe_skin | YFB_cap_tissue | 1.000000 | no |
DIF_stipe_skin | YFB_gill_tissue | 1.000000 | no |
DIF_stipe_skin | YFB_veil | 1.000000 | no |
DIF_stipe_skin | DIF_cap_skin | 1.000000 | no |
DIF_stipe_skin | DIF_cap_tissue | 1.000000 | no |
DIF_cap_skin | DIF_gill_tissue | 1.000000 | no |
DIF_cap_skin | YFB_stipe_center | 1.000000 | no |
DIF_cap_skin | YFB_stipe_shell | 0.771443 | no |
DIF_cap_skin | YFB_stipe_skin | 1.000000 | no |
DIF_cap_skin | YFB_cap_skin | 1.000000 | no |
DIF_cap_skin | YFB_cap_tissue | 1.000000 | no |
DIF_cap_skin | YFB_gill_tissue | 1.000000 | no |
DIF_cap_skin | YFB_veil | 1.000000 | no |
DIF_cap_skin | DIF_cap_tissue | 1.000000 | no |
DIF_cap_tissue | DIF_gill_tissue | 1.000000 | no |
DIF_cap_tissue | YFB_stipe_center | 1.000000 | no |
DIF_cap_tissue | YFB_stipe_shell | 0.935976 | no |
DIF_cap_tissue | YFB_stipe_skin | 1.000000 | no |
DIF_cap_tissue | YFB_cap_skin | 1.000000 | no |
DIF_cap_tissue | YFB_cap_tissue | 1.000000 | no |
DIF_cap_tissue | YFB_gill_tissue | 1.000000 | no |
DIF_cap_tissue | YFB_veil | 1.000000 | no |
Type of sequence | Sequence |
---|---|
Locus | Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded. |
Protein | >AgabiH97|077820 MKFALAPIVSVFFALSAMGSPTSKKRDTTLEVEARQAQCDIATCLQTIGNETAGIIVPCGLAINNLANISQAIAQ GQQPSQADVTGLTSNTVQCVFQSIAAGFAIPAACLSCVF* |
Coding | >AgabiH97|077820 ATGAAATTTGCACTCGCACCCATCGTCTCGGTCTTTTTCGCATTATCCGCCATGGGCAGTCCTACCAGCAAAAAG CGGGACACCACCCTTGAGGTTGAAGCTCGTCAAGCGCAGTGTGATATTGCCACATGTCTTCAAACAATCGGAAAC GAGACCGCAGGAATTATAGTCCCTTGTGGACTGGCTATCAACAACCTGGCAAATATTAGTCAGGCCATTGCTCAA GGTCAACAACCGAGCCAGGCTGATGTGACCGGCCTTACCTCCAACACTGTCCAGTGCGTCTTTCAGAGTATCGCC GCAGGATTCGCTATTCCTGCTGCTTGTTTGAGCTGTGTCTTTTAG |
Transcript | >AgabiH97|077820 ATGAAATTTGCACTCGCACCCATCGTCTCGGTCTTTTTCGCATTATCCGCCATGGGCAGTCCTACCAGCAAAAAG CGGGACACCACCCTTGAGGTTGAAGCTCGTCAAGCGCAGTGTGATATTGCCACATGTCTTCAAACAATCGGAAAC GAGACCGCAGGAATTATAGTCCCTTGTGGACTGGCTATCAACAACCTGGCAAATATTAGTCAGGCCATTGCTCAA GGTCAACAACCGAGCCAGGCTGATGTGACCGGCCTTACCTCCAACACTGTCCAGTGCGTCTTTCAGAGTATCGCC GCAGGATTCGCTATTCCTGCTGCTTGTTTGAGCTGTGTCTTTTAG |
Gene | >AgabiH97|077820 ATGAAATTTGCACTCGCACCCATCGTCTCGGTCTTTTTCGCATTATCCGCCATGGGCAGTCCTACCAGCAAAAAG CGGGACACCACCCTTGAGGTTGAAGCTCGTCAAGCGCAGTGTGATATTGCCAGTGCGTTGACTTGTATCGTTTAT CATAGAATATTAGTACTCAACTTTCCTTCAGCATGTCTTCAAACAATCGGAAACGAGACCGCAGGAATTATAGTC CCTTGTGGACTGGCTATCAACAACCTGGCAAATATTAGTCAGGCCATTGCTCAAGGTCAACAACCGAGTAAGTAC AATCATACAAAAAAAAAAAACTAAAAATCCTGAAGTGTCCGTTTAGGCCAGGCTGATGTGACCGGCCTTACCTCC AACACTGTCCAGTGCGTCTTTCAGAGTATCGCCGCAGGATTCGCTATTGTAAGTCTTACTTTTGAATAACGATGT TGCACAAAGTCGTTAATCCTACGGTAACCCAGCCTGCTGCTTGTTTGAGCTGTGTCTTTTAG |