Fungal Genomics

at Utrecht University

General Properties

Protein IDAgabiH97|077820
Gene name
Locationscaffold_4:2999149..2999661
Strand-
Gene length (bp)512
Transcript length (bp)345
Coding sequence length (bp)345
Protein length (aa) 115

Your browser does not support drawing a protein figure.

PFAM Domains

(None)

Swissprot hits

(None)

GO

(None)

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
Yes 1 - 20 0.45

Transmembrane Domains

(None)

Transcription Factor Class

(None)

Expression data

Analysis 1: Developmental stages of Agaricus bisporus (strain A15). Published in Pelkmans et al, Applied Microbiology and Biotechnology, 2016

Expression values

Label Description Expression (RPKM) Confidence interval (low) Confidence interval (high)
Casing Casing mycelium 18.65 6.78 30.52
Initials Initials knots 1.80 0.00 3.90
Pileal_Stipeal_center Stage I stipe center 0.94 0.00 2.32
Pileal_Stipeal_shell Stage I stipe shell 0.00 0.00 0.00
DIF_stipe_center Stage II stipe center 0.00 0.00 0.00
DIF_stipe_shell Stage II stipe shell 1.00 0.00 2.48
DIF_stipe_skin Stage II stipe skin 0.23 0.00 0.65
DIF_cap_skin Stage II cap skin 0.15 0.00 0.45
DIF_cap_tissue Stage II cap tissue 0.31 0.00 0.72
DIF_gill_tissue Stage II gill tissue 0.29 0.00 0.71
YFB_stipe_center Young fruiting body stipe center 0.32 0.00 1.12
YFB_stipe_shell Young fruiting body stipe shell 0.35 0.00 1.15
YFB_stipe_skin Young fruiting body stipe skin 0.00 0.00 0.00
YFB_cap_skin Young fruiting body cap skin 0.00 0.00 0.00
YFB_cap_tissue Young fruiting body cap tissue 0.11 0.00 0.40
YFB_gill_tissue Young fruiting body gill tissue 0.30 0.00 1.09
YFB_veil Young fruiting body veil 0.00 0.00 0.00

Differential expression

Label1 Label2 Q-value Significant difference
Casing DIF_gill_tissue 0.368389 no
Casing YFB_stipe_center 0.331349 no
Casing YFB_stipe_shell 0.309271 no
Casing YFB_stipe_skin 0.000613 yes
Casing YFB_cap_skin 0.000613 yes
Casing YFB_cap_tissue 0.494252 no
Casing YFB_gill_tissue 0.348798 no
Casing YFB_veil 0.000613 yes
Casing Initials 0.006032 yes
Casing Pileal_Stipeal_center 0.032038 yes
Casing Pileal_Stipeal_shell 0.000613 yes
Casing DIF_stipe_center 0.000613 yes
Casing DIF_stipe_shell 0.030610 yes
Casing DIF_stipe_skin 0.426345 no
Casing DIF_cap_skin 0.512033 no
Casing DIF_cap_tissue 0.359772 no
DIF_gill_tissue YFB_stipe_center 1.000000 no
DIF_gill_tissue YFB_stipe_shell 0.931990 no
DIF_gill_tissue YFB_stipe_skin 1.000000 no
DIF_gill_tissue YFB_cap_skin 1.000000 no
DIF_gill_tissue YFB_cap_tissue 1.000000 no
DIF_gill_tissue YFB_gill_tissue 1.000000 no
DIF_gill_tissue YFB_veil 1.000000 no
YFB_stipe_center YFB_stipe_shell 0.935311 no
YFB_stipe_center YFB_stipe_skin 1.000000 no
YFB_stipe_center YFB_cap_skin 1.000000 no
YFB_stipe_center YFB_cap_tissue 1.000000 no
YFB_stipe_center YFB_gill_tissue 1.000000 no
YFB_stipe_center YFB_veil 1.000000 no
YFB_stipe_shell YFB_stipe_skin 0.191454 no
YFB_stipe_shell YFB_cap_skin 0.191454 no
YFB_stipe_shell YFB_cap_tissue 0.694970 no
YFB_stipe_shell YFB_gill_tissue 0.932526 no
YFB_stipe_shell YFB_veil 0.191454 no
YFB_stipe_skin YFB_cap_skin 1.000000 no
YFB_stipe_skin YFB_cap_tissue 1.000000 no
YFB_stipe_skin YFB_gill_tissue 1.000000 no
YFB_stipe_skin YFB_veil 1.000000 no
YFB_cap_skin YFB_cap_tissue 1.000000 no
YFB_cap_skin YFB_gill_tissue 1.000000 no
YFB_cap_skin YFB_veil 1.000000 no
YFB_cap_tissue YFB_gill_tissue 1.000000 no
YFB_cap_tissue YFB_veil 1.000000 no
YFB_gill_tissue YFB_veil 1.000000 no
Initials DIF_gill_tissue 0.381187 no
Initials YFB_stipe_center 0.361281 no
Initials YFB_stipe_shell 0.346962 no
Initials YFB_stipe_skin 0.000613 yes
Initials YFB_cap_skin 0.000613 yes
Initials YFB_cap_tissue 0.494425 no
Initials YFB_gill_tissue 0.371318 no
Initials YFB_veil 0.000613 yes
Initials Pileal_Stipeal_center 0.596083 no
Initials Pileal_Stipeal_shell 0.000613 yes
Initials DIF_stipe_center 0.000613 yes
Initials DIF_stipe_shell 0.641529 no
Initials DIF_stipe_skin 0.429326 no
Initials DIF_cap_skin 0.512352 no
Initials DIF_cap_tissue 0.385853 no
Pileal_Stipeal_center DIF_gill_tissue 0.527988 no
Pileal_Stipeal_center YFB_stipe_center 0.584664 no
Pileal_Stipeal_center YFB_stipe_shell 0.586122 no
Pileal_Stipeal_center YFB_stipe_skin 0.016949 yes
Pileal_Stipeal_center YFB_cap_skin 0.016949 yes
Pileal_Stipeal_center YFB_cap_tissue 0.507422 no
Pileal_Stipeal_center YFB_gill_tissue 0.519590 no
Pileal_Stipeal_center YFB_veil 0.016949 yes
Pileal_Stipeal_center Pileal_Stipeal_shell 0.016949 yes
Pileal_Stipeal_center DIF_stipe_center 0.016949 yes
Pileal_Stipeal_center DIF_stipe_shell 0.968382 no
Pileal_Stipeal_center DIF_stipe_skin 0.493785 no
Pileal_Stipeal_center DIF_cap_skin 0.534672 no
Pileal_Stipeal_center DIF_cap_tissue 0.529214 no
Pileal_Stipeal_shell DIF_gill_tissue 1.000000 no
Pileal_Stipeal_shell YFB_stipe_center 1.000000 no
Pileal_Stipeal_shell YFB_stipe_shell 0.193015 no
Pileal_Stipeal_shell YFB_stipe_skin 1.000000 no
Pileal_Stipeal_shell YFB_cap_skin 1.000000 no
Pileal_Stipeal_shell YFB_cap_tissue 1.000000 no
Pileal_Stipeal_shell YFB_gill_tissue 1.000000 no
Pileal_Stipeal_shell YFB_veil 1.000000 no
Pileal_Stipeal_shell DIF_stipe_center 1.000000 no
Pileal_Stipeal_shell DIF_stipe_shell 0.018624 yes
Pileal_Stipeal_shell DIF_stipe_skin 1.000000 no
Pileal_Stipeal_shell DIF_cap_skin 1.000000 no
Pileal_Stipeal_shell DIF_cap_tissue 1.000000 no
DIF_stipe_center DIF_gill_tissue 1.000000 no
DIF_stipe_center YFB_stipe_center 1.000000 no
DIF_stipe_center YFB_stipe_shell 0.193015 no
DIF_stipe_center YFB_stipe_skin 1.000000 no
DIF_stipe_center YFB_cap_skin 1.000000 no
DIF_stipe_center YFB_cap_tissue 1.000000 no
DIF_stipe_center YFB_gill_tissue 1.000000 no
DIF_stipe_center YFB_veil 1.000000 no
DIF_stipe_center DIF_stipe_shell 0.018624 yes
DIF_stipe_center DIF_stipe_skin 1.000000 no
DIF_stipe_center DIF_cap_skin 1.000000 no
DIF_stipe_center DIF_cap_tissue 1.000000 no
DIF_stipe_shell DIF_gill_tissue 0.534672 no
DIF_stipe_shell YFB_stipe_center 0.530712 no
DIF_stipe_shell YFB_stipe_shell 0.596601 no
DIF_stipe_shell YFB_stipe_skin 0.014081 yes
DIF_stipe_shell YFB_cap_skin 0.014081 yes
DIF_stipe_shell YFB_cap_tissue 0.505957 no
DIF_stipe_shell YFB_gill_tissue 0.533104 no
DIF_stipe_shell YFB_veil 0.014081 yes
DIF_stipe_shell DIF_stipe_skin 0.500671 no
DIF_stipe_shell DIF_cap_skin 0.534722 no
DIF_stipe_shell DIF_cap_tissue 0.545481 no
DIF_stipe_skin DIF_gill_tissue 1.000000 no
DIF_stipe_skin YFB_stipe_center 1.000000 no
DIF_stipe_skin YFB_stipe_shell 0.869097 no
DIF_stipe_skin YFB_stipe_skin 1.000000 no
DIF_stipe_skin YFB_cap_skin 1.000000 no
DIF_stipe_skin YFB_cap_tissue 1.000000 no
DIF_stipe_skin YFB_gill_tissue 1.000000 no
DIF_stipe_skin YFB_veil 1.000000 no
DIF_stipe_skin DIF_cap_skin 1.000000 no
DIF_stipe_skin DIF_cap_tissue 1.000000 no
DIF_cap_skin DIF_gill_tissue 1.000000 no
DIF_cap_skin YFB_stipe_center 1.000000 no
DIF_cap_skin YFB_stipe_shell 0.771443 no
DIF_cap_skin YFB_stipe_skin 1.000000 no
DIF_cap_skin YFB_cap_skin 1.000000 no
DIF_cap_skin YFB_cap_tissue 1.000000 no
DIF_cap_skin YFB_gill_tissue 1.000000 no
DIF_cap_skin YFB_veil 1.000000 no
DIF_cap_skin DIF_cap_tissue 1.000000 no
DIF_cap_tissue DIF_gill_tissue 1.000000 no
DIF_cap_tissue YFB_stipe_center 1.000000 no
DIF_cap_tissue YFB_stipe_shell 0.935976 no
DIF_cap_tissue YFB_stipe_skin 1.000000 no
DIF_cap_tissue YFB_cap_skin 1.000000 no
DIF_cap_tissue YFB_cap_tissue 1.000000 no
DIF_cap_tissue YFB_gill_tissue 1.000000 no
DIF_cap_tissue YFB_veil 1.000000 no

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >AgabiH97|077820
MKFALAPIVSVFFALSAMGSPTSKKRDTTLEVEARQAQCDIATCLQTIGNETAGIIVPCGLAINNLANISQAIAQ
GQQPSQADVTGLTSNTVQCVFQSIAAGFAIPAACLSCVF*
Coding >AgabiH97|077820
ATGAAATTTGCACTCGCACCCATCGTCTCGGTCTTTTTCGCATTATCCGCCATGGGCAGTCCTACCAGCAAAAAG
CGGGACACCACCCTTGAGGTTGAAGCTCGTCAAGCGCAGTGTGATATTGCCACATGTCTTCAAACAATCGGAAAC
GAGACCGCAGGAATTATAGTCCCTTGTGGACTGGCTATCAACAACCTGGCAAATATTAGTCAGGCCATTGCTCAA
GGTCAACAACCGAGCCAGGCTGATGTGACCGGCCTTACCTCCAACACTGTCCAGTGCGTCTTTCAGAGTATCGCC
GCAGGATTCGCTATTCCTGCTGCTTGTTTGAGCTGTGTCTTTTAG
Transcript >AgabiH97|077820
ATGAAATTTGCACTCGCACCCATCGTCTCGGTCTTTTTCGCATTATCCGCCATGGGCAGTCCTACCAGCAAAAAG
CGGGACACCACCCTTGAGGTTGAAGCTCGTCAAGCGCAGTGTGATATTGCCACATGTCTTCAAACAATCGGAAAC
GAGACCGCAGGAATTATAGTCCCTTGTGGACTGGCTATCAACAACCTGGCAAATATTAGTCAGGCCATTGCTCAA
GGTCAACAACCGAGCCAGGCTGATGTGACCGGCCTTACCTCCAACACTGTCCAGTGCGTCTTTCAGAGTATCGCC
GCAGGATTCGCTATTCCTGCTGCTTGTTTGAGCTGTGTCTTTTAG
Gene >AgabiH97|077820
ATGAAATTTGCACTCGCACCCATCGTCTCGGTCTTTTTCGCATTATCCGCCATGGGCAGTCCTACCAGCAAAAAG
CGGGACACCACCCTTGAGGTTGAAGCTCGTCAAGCGCAGTGTGATATTGCCAGTGCGTTGACTTGTATCGTTTAT
CATAGAATATTAGTACTCAACTTTCCTTCAGCATGTCTTCAAACAATCGGAAACGAGACCGCAGGAATTATAGTC
CCTTGTGGACTGGCTATCAACAACCTGGCAAATATTAGTCAGGCCATTGCTCAAGGTCAACAACCGAGTAAGTAC
AATCATACAAAAAAAAAAAACTAAAAATCCTGAAGTGTCCGTTTAGGCCAGGCTGATGTGACCGGCCTTACCTCC
AACACTGTCCAGTGCGTCTTTCAGAGTATCGCCGCAGGATTCGCTATTGTAAGTCTTACTTTTGAATAACGATGT
TGCACAAAGTCGTTAATCCTACGGTAACCCAGCCTGCTGCTTGTTTGAGCTGTGTCTTTTAG

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail