© 2022 - Robin Ohm - Utrecht University - The Netherlands
Built with Python Django and Wagtail
| Protein ID | AgabiH97|057820 |
| Gene name | |
| Location | scaffold_3:1256305..1257062 |
| Strand | + |
| Gene length (bp) | 757 |
| Transcript length (bp) | 330 |
| Coding sequence length (bp) | 330 |
| Protein length (aa) | 110 |
| PFAM Domain ID | Short name | Long name | E-value | Start | End |
|---|---|---|---|---|---|
| PF00378 | ECH_1 | Enoyl-CoA hydratase/isomerase | 3.6E-09 | 22 | 81 |
| PF16113 | ECH_2 | Enoyl-CoA hydratase/isomerase | 1.6E-08 | 27 | 81 |
| GO Term | Description | Terminal node |
|---|---|---|
| GO:0003824 | catalytic activity | Yes |
| GO:0003674 | molecular_function | No |
| SignalP signal predicted | Location (based on Ymax) |
D score (significance: > 0.45) |
|---|---|---|
| No | 1 - 26 | 0.45 |
Expression values
| Label | Description | Expression (RPKM) | Confidence interval (low) | Confidence interval (high) |
|---|---|---|---|---|
| Casing | Casing mycelium | 51.23 | 22.12 | 80.34 |
| Initials | Initials knots | 45.06 | 19.48 | 70.65 |
| Pileal_Stipeal_center | Stage I stipe center | 32.12 | 12.92 | 51.32 |
| Pileal_Stipeal_shell | Stage I stipe shell | 56.89 | 25.72 | 88.07 |
| DIF_stipe_center | Stage II stipe center | 38.53 | 16.23 | 60.84 |
| DIF_stipe_shell | Stage II stipe shell | 21.36 | 7.57 | 35.15 |
| DIF_stipe_skin | Stage II stipe skin | 40.93 | 16.71 | 65.16 |
| DIF_cap_skin | Stage II cap skin | 122.39 | 60.64 | 184.14 |
| DIF_cap_tissue | Stage II cap tissue | 138.93 | 69.08 | 208.78 |
| DIF_gill_tissue | Stage II gill tissue | 47.06 | 20.20 | 73.93 |
| YFB_stipe_center | Young fruiting body stipe center | 33.77 | 13.80 | 53.75 |
| YFB_stipe_shell | Young fruiting body stipe shell | 39.58 | 16.81 | 62.36 |
| YFB_stipe_skin | Young fruiting body stipe skin | 32.67 | 13.20 | 52.15 |
| YFB_cap_skin | Young fruiting body cap skin | 113.36 | 56.52 | 170.19 |
| YFB_cap_tissue | Young fruiting body cap tissue | 108.58 | 53.95 | 163.20 |
| YFB_gill_tissue | Young fruiting body gill tissue | 60.70 | 27.59 | 93.81 |
| YFB_veil | Young fruiting body veil | 45.32 | 18.55 | 72.08 |
Differential expression
| Label1 | Label2 | Q-value | Significant difference |
|---|---|---|---|
| Casing | DIF_gill_tissue | 0.905786 | no |
| Casing | YFB_stipe_center | 0.381405 | no |
| Casing | YFB_stipe_shell | 0.632718 | no |
| Casing | YFB_stipe_skin | 0.323512 | no |
| Casing | YFB_cap_skin | 0.024946 | yes |
| Casing | YFB_cap_tissue | 0.032504 | yes |
| Casing | YFB_gill_tissue | 0.779787 | no |
| Casing | YFB_veil | 0.860488 | no |
| Casing | Initials | 0.848908 | no |
| Casing | Pileal_Stipeal_center | 0.309085 | no |
| Casing | Pileal_Stipeal_shell | 0.878816 | no |
| Casing | DIF_stipe_center | 0.592303 | no |
| Casing | DIF_stipe_shell | 0.025205 | yes |
| Casing | DIF_stipe_skin | 0.702051 | no |
| Casing | DIF_cap_skin | 0.011968 | yes |
| Casing | DIF_cap_tissue | 0.003365 | yes |
| DIF_gill_tissue | YFB_stipe_center | 0.525127 | no |
| DIF_gill_tissue | YFB_stipe_shell | 0.779294 | no |
| DIF_gill_tissue | YFB_stipe_skin | 0.466367 | no |
| DIF_gill_tissue | YFB_cap_skin | 0.017507 | yes |
| DIF_gill_tissue | YFB_cap_tissue | 0.021322 | yes |
| DIF_gill_tissue | YFB_gill_tissue | 0.634790 | no |
| DIF_gill_tissue | YFB_veil | 0.962390 | no |
| YFB_stipe_center | YFB_stipe_shell | 0.811782 | no |
| YFB_stipe_center | YFB_stipe_skin | 0.968853 | no |
| YFB_stipe_center | YFB_cap_skin | 0.000613 | yes |
| YFB_stipe_center | YFB_cap_tissue | 0.000613 | yes |
| YFB_stipe_center | YFB_gill_tissue | 0.153833 | no |
| YFB_stipe_center | YFB_veil | 0.601526 | no |
| YFB_stipe_shell | YFB_stipe_skin | 0.760298 | no |
| YFB_stipe_shell | YFB_cap_skin | 0.004160 | yes |
| YFB_stipe_shell | YFB_cap_tissue | 0.004928 | yes |
| YFB_stipe_shell | YFB_gill_tissue | 0.333088 | no |
| YFB_stipe_shell | YFB_veil | 0.844986 | no |
| YFB_stipe_skin | YFB_cap_skin | 0.000613 | yes |
| YFB_stipe_skin | YFB_cap_tissue | 0.000613 | yes |
| YFB_stipe_skin | YFB_gill_tissue | 0.119156 | no |
| YFB_stipe_skin | YFB_veil | 0.539363 | no |
| YFB_cap_skin | YFB_cap_tissue | 0.949707 | no |
| YFB_cap_skin | YFB_gill_tissue | 0.083328 | no |
| YFB_cap_skin | YFB_veil | 0.013485 | yes |
| YFB_cap_tissue | YFB_gill_tissue | 0.114583 | no |
| YFB_cap_tissue | YFB_veil | 0.017226 | yes |
| YFB_gill_tissue | YFB_veil | 0.574299 | no |
| Initials | DIF_gill_tissue | 0.956635 | no |
| Initials | YFB_stipe_center | 0.600673 | no |
| Initials | YFB_stipe_shell | 0.851318 | no |
| Initials | YFB_stipe_skin | 0.540289 | no |
| Initials | YFB_cap_skin | 0.011041 | yes |
| Initials | YFB_cap_tissue | 0.014668 | yes |
| Initials | YFB_gill_tissue | 0.557363 | no |
| Initials | YFB_veil | 0.993810 | no |
| Initials | Pileal_Stipeal_center | 0.514431 | no |
| Initials | Pileal_Stipeal_shell | 0.680358 | no |
| Initials | DIF_stipe_center | 0.812589 | no |
| Initials | DIF_stipe_shell | 0.068461 | no |
| Initials | DIF_stipe_skin | 0.898901 | no |
| Initials | DIF_cap_skin | 0.005302 | yes |
| Initials | DIF_cap_tissue | 0.000613 | yes |
| Pileal_Stipeal_center | DIF_gill_tissue | 0.448483 | no |
| Pileal_Stipeal_center | YFB_stipe_center | 0.951414 | no |
| Pileal_Stipeal_center | YFB_stipe_shell | 0.730764 | no |
| Pileal_Stipeal_center | YFB_stipe_skin | 0.983214 | no |
| Pileal_Stipeal_center | YFB_cap_skin | 0.001140 | yes |
| Pileal_Stipeal_center | YFB_cap_tissue | 0.000613 | yes |
| Pileal_Stipeal_center | YFB_gill_tissue | 0.116723 | no |
| Pileal_Stipeal_center | YFB_veil | 0.517801 | no |
| Pileal_Stipeal_center | Pileal_Stipeal_shell | 0.176565 | no |
| Pileal_Stipeal_center | DIF_stipe_center | 0.775991 | no |
| Pileal_Stipeal_center | DIF_stipe_shell | 0.430967 | no |
| Pileal_Stipeal_center | DIF_stipe_skin | 0.684684 | no |
| Pileal_Stipeal_center | DIF_cap_skin | 0.000613 | yes |
| Pileal_Stipeal_center | DIF_cap_tissue | 0.000613 | yes |
| Pileal_Stipeal_shell | DIF_gill_tissue | 0.746751 | no |
| Pileal_Stipeal_shell | YFB_stipe_center | 0.229368 | no |
| Pileal_Stipeal_shell | YFB_stipe_shell | 0.438285 | no |
| Pileal_Stipeal_shell | YFB_stipe_skin | 0.182683 | no |
| Pileal_Stipeal_shell | YFB_cap_skin | 0.053150 | no |
| Pileal_Stipeal_shell | YFB_cap_tissue | 0.069197 | no |
| Pileal_Stipeal_shell | YFB_gill_tissue | 0.926532 | no |
| Pileal_Stipeal_shell | YFB_veil | 0.688376 | no |
| Pileal_Stipeal_shell | DIF_stipe_center | 0.392592 | no |
| Pileal_Stipeal_shell | DIF_stipe_shell | 0.011041 | yes |
| Pileal_Stipeal_shell | DIF_stipe_skin | 0.506697 | no |
| Pileal_Stipeal_shell | DIF_cap_skin | 0.025458 | yes |
| Pileal_Stipeal_shell | DIF_cap_tissue | 0.007782 | yes |
| DIF_stipe_center | DIF_gill_tissue | 0.736975 | no |
| DIF_stipe_center | YFB_stipe_center | 0.848833 | no |
| DIF_stipe_center | YFB_stipe_shell | 0.972045 | no |
| DIF_stipe_center | YFB_stipe_skin | 0.797440 | no |
| DIF_stipe_center | YFB_cap_skin | 0.002525 | yes |
| DIF_stipe_center | YFB_cap_tissue | 0.002951 | yes |
| DIF_stipe_center | YFB_gill_tissue | 0.287292 | no |
| DIF_stipe_center | YFB_veil | 0.800492 | no |
| DIF_stipe_center | DIF_stipe_shell | 0.179947 | no |
| DIF_stipe_center | DIF_stipe_skin | 0.938099 | no |
| DIF_stipe_center | DIF_cap_skin | 0.001140 | yes |
| DIF_stipe_center | DIF_cap_tissue | 0.000613 | yes |
| DIF_stipe_shell | DIF_gill_tissue | 0.051520 | no |
| DIF_stipe_shell | YFB_stipe_center | 0.359694 | no |
| DIF_stipe_shell | YFB_stipe_shell | 0.154391 | no |
| DIF_stipe_shell | YFB_stipe_skin | 0.396816 | no |
| DIF_stipe_shell | YFB_cap_skin | 0.000613 | yes |
| DIF_stipe_shell | YFB_cap_tissue | 0.000613 | yes |
| DIF_stipe_shell | YFB_gill_tissue | 0.007439 | yes |
| DIF_stipe_shell | YFB_veil | 0.074840 | no |
| DIF_stipe_shell | DIF_stipe_skin | 0.137029 | no |
| DIF_stipe_shell | DIF_cap_skin | 0.000613 | yes |
| DIF_stipe_shell | DIF_cap_tissue | 0.000613 | yes |
| DIF_stipe_skin | DIF_gill_tissue | 0.840680 | no |
| DIF_stipe_skin | YFB_stipe_center | 0.767719 | no |
| DIF_stipe_skin | YFB_stipe_shell | 0.966472 | no |
| DIF_stipe_skin | YFB_stipe_skin | 0.711125 | no |
| DIF_stipe_skin | YFB_cap_skin | 0.005671 | yes |
| DIF_stipe_skin | YFB_cap_tissue | 0.008121 | yes |
| DIF_stipe_skin | YFB_gill_tissue | 0.396501 | no |
| DIF_stipe_skin | YFB_veil | 0.893619 | no |
| DIF_stipe_skin | DIF_cap_skin | 0.002525 | yes |
| DIF_stipe_skin | DIF_cap_tissue | 0.001140 | yes |
| DIF_cap_skin | DIF_gill_tissue | 0.006387 | yes |
| DIF_cap_skin | YFB_stipe_center | 0.000613 | yes |
| DIF_cap_skin | YFB_stipe_shell | 0.002084 | yes |
| DIF_cap_skin | YFB_stipe_skin | 0.000613 | yes |
| DIF_cap_skin | YFB_cap_skin | 0.905844 | no |
| DIF_cap_skin | YFB_cap_tissue | 0.837318 | no |
| DIF_cap_skin | YFB_gill_tissue | 0.041603 | yes |
| DIF_cap_skin | YFB_veil | 0.007092 | yes |
| DIF_cap_skin | DIF_cap_tissue | 0.825715 | no |
| DIF_cap_tissue | DIF_gill_tissue | 0.001625 | yes |
| DIF_cap_tissue | YFB_stipe_center | 0.000613 | yes |
| DIF_cap_tissue | YFB_stipe_shell | 0.000613 | yes |
| DIF_cap_tissue | YFB_stipe_skin | 0.000613 | yes |
| DIF_cap_tissue | YFB_cap_skin | 0.688016 | no |
| DIF_cap_tissue | YFB_cap_tissue | 0.601692 | no |
| DIF_cap_tissue | YFB_gill_tissue | 0.016949 | yes |
| DIF_cap_tissue | YFB_veil | 0.002084 | yes |
| Type of sequence | Sequence |
|---|---|
| Locus | Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded. |
| Protein | >AgabiH97|057820 MRLVSNTLPHRLFGMASITIEVSEGIATVQLNRPATLNALLPEDYDALAKALREIDEREDVIVTVLQATGKWFCA GTSVQQGVVFTSKSSCGRAERSSDGNRGCITGSV* |
| Coding | >AgabiH97|057820 ATGCGTCTTGTTTCGAACACTCTTCCACATAGATTGTTCGGTATGGCGAGTATCACTATCGAGGTTTCCGAAGGC ATTGCAACTGTCCAGCTCAACCGTCCAGCTACTTTGAATGCTCTTCTTCCCGAAGACTACGACGCCCTCGCAAAG GCATTGAGGGAAATTGACGAGAGGGAAGATGTTATTGTCACAGTTCTGCAAGCTACTGGCAAATGGTTCTGCGCA GGAACGAGCGTCCAGCAAGGCGTTGTATTCACATCGAAAAGTTCTTGTGGCCGCGCTGAACGGTCCAGTGATGGG AATCGCGGCTGCATTACTGGGTCAGTTTGA |
| Transcript | >AgabiH97|057820 ATGCGTCTTGTTTCGAACACTCTTCCACATAGATTGTTCGGTATGGCGAGTATCACTATCGAGGTTTCCGAAGGC ATTGCAACTGTCCAGCTCAACCGTCCAGCTACTTTGAATGCTCTTCTTCCCGAAGACTACGACGCCCTCGCAAAG GCATTGAGGGAAATTGACGAGAGGGAAGATGTTATTGTCACAGTTCTGCAAGCTACTGGCAAATGGTTCTGCGCA GGAACGAGCGTCCAGCAAGGCGTTGTATTCACATCGAAAAGTTCTTGTGGCCGCGCTGAACGGTCCAGTGATGGG AATCGCGGCTGCATTACTGGGTCAGTTTGA |
| Gene | >AgabiH97|057820 ATGCGTCTTGTTTCGAACACTCTTCCACATAGATTGTTCGGTATGGCGAGTATCACTATCGAGGTTTCCGAAGGC ATTGCAACTGTCCAGCTCAACCGTCCAGCTACTTTGAATGCTCTTCTTCCCGAAGGTAAGTTAACAAAGCCATCA CTTACTATATTCGTAAGCAAGTAGTAATCACAACCTATATTCAGACTACGACGCCCTCGCAAAGGCATTGAGGGA AATTGACGAGAGGGAAGATGTTATTGTCACAGTTCTGCAAGGTAAAAACGCGCAAGTTATTCGGGAATGTAAAGC TGAATGATGGCACCATGACAAGCTACTGGCAAATGGTTCTGCGCGTAAGTAATCTTTACCAATGCAAACAACCCT GCGGCGAACCTCATATTGTTTCAGAGGAACGAGCGTCCAGGTAAGAGATACGGAAAAGAAATTGGAAGGCGTTGG CGATATCCGGAAAGCCCTATTCAACAACGTTACGCCCACAACACTTGACTGTAGCAAGGCGGTACGTCGTTGCCA AAATCAATTTGGACTGAAAAATCAATGATATTTTATTAGTTGTATTCACATCGAAAAGTTCTTGTGGCCGCGCTG AACGGTCCAGTGATGGGTAGATTGTTATTTGCATCTTCTCATTTTGCCTCATAAGCTCACCTCATCATAGGAATC GCGGCTGGTATGCCTGCAGTTGATTACCTATGTGCGAGAGGGTCTAACATTTGTCTTGTCAAGCATTACTGGGTC AGTTTGA |