Fungal Genomics

at Utrecht University

General Properties

Protein IDAgabiH97|057820
Gene name
Locationscaffold_3:1256305..1257062
Strand+
Gene length (bp)757
Transcript length (bp)330
Coding sequence length (bp)330
Protein length (aa) 110

Your browser does not support drawing a protein figure.

PFAM Domains

PFAM Domain ID Short name Long name E-value Start End
PF00378 ECH_1 Enoyl-CoA hydratase/isomerase 3.6E-09 22 81
PF16113 ECH_2 Enoyl-CoA hydratase/isomerase 1.6E-08 27 81

Swissprot hits

(None)

GO

GO Term Description Terminal node
GO:0003824 catalytic activity Yes
GO:0003674 molecular_function No

SignalP

[Help with interpreting these statistics]
SignalP signal predicted Location
(based on Ymax)
D score
(significance: > 0.45)
No 1 - 26 0.45

Transmembrane Domains

(None)

Transcription Factor Class

(None)

Expression data

Analysis 1: Developmental stages of Agaricus bisporus (strain A15). Published in Pelkmans et al, Applied Microbiology and Biotechnology, 2016

Click here for more information

Sequences

Type of sequenceSequence
Locus Download genbank file of locus
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded.
Protein >AgabiH97|057820
MRLVSNTLPHRLFGMASITIEVSEGIATVQLNRPATLNALLPEDYDALAKALREIDEREDVIVTVLQATGKWFCA
GTSVQQGVVFTSKSSCGRAERSSDGNRGCITGSV*
Coding >AgabiH97|057820
ATGCGTCTTGTTTCGAACACTCTTCCACATAGATTGTTCGGTATGGCGAGTATCACTATCGAGGTTTCCGAAGGC
ATTGCAACTGTCCAGCTCAACCGTCCAGCTACTTTGAATGCTCTTCTTCCCGAAGACTACGACGCCCTCGCAAAG
GCATTGAGGGAAATTGACGAGAGGGAAGATGTTATTGTCACAGTTCTGCAAGCTACTGGCAAATGGTTCTGCGCA
GGAACGAGCGTCCAGCAAGGCGTTGTATTCACATCGAAAAGTTCTTGTGGCCGCGCTGAACGGTCCAGTGATGGG
AATCGCGGCTGCATTACTGGGTCAGTTTGA
Transcript >AgabiH97|057820
ATGCGTCTTGTTTCGAACACTCTTCCACATAGATTGTTCGGTATGGCGAGTATCACTATCGAGGTTTCCGAAGGC
ATTGCAACTGTCCAGCTCAACCGTCCAGCTACTTTGAATGCTCTTCTTCCCGAAGACTACGACGCCCTCGCAAAG
GCATTGAGGGAAATTGACGAGAGGGAAGATGTTATTGTCACAGTTCTGCAAGCTACTGGCAAATGGTTCTGCGCA
GGAACGAGCGTCCAGCAAGGCGTTGTATTCACATCGAAAAGTTCTTGTGGCCGCGCTGAACGGTCCAGTGATGGG
AATCGCGGCTGCATTACTGGGTCAGTTTGA
Gene >AgabiH97|057820
ATGCGTCTTGTTTCGAACACTCTTCCACATAGATTGTTCGGTATGGCGAGTATCACTATCGAGGTTTCCGAAGGC
ATTGCAACTGTCCAGCTCAACCGTCCAGCTACTTTGAATGCTCTTCTTCCCGAAGGTAAGTTAACAAAGCCATCA
CTTACTATATTCGTAAGCAAGTAGTAATCACAACCTATATTCAGACTACGACGCCCTCGCAAAGGCATTGAGGGA
AATTGACGAGAGGGAAGATGTTATTGTCACAGTTCTGCAAGGTAAAAACGCGCAAGTTATTCGGGAATGTAAAGC
TGAATGATGGCACCATGACAAGCTACTGGCAAATGGTTCTGCGCGTAAGTAATCTTTACCAATGCAAACAACCCT
GCGGCGAACCTCATATTGTTTCAGAGGAACGAGCGTCCAGGTAAGAGATACGGAAAAGAAATTGGAAGGCGTTGG
CGATATCCGGAAAGCCCTATTCAACAACGTTACGCCCACAACACTTGACTGTAGCAAGGCGGTACGTCGTTGCCA
AAATCAATTTGGACTGAAAAATCAATGATATTTTATTAGTTGTATTCACATCGAAAAGTTCTTGTGGCCGCGCTG
AACGGTCCAGTGATGGGTAGATTGTTATTTGCATCTTCTCATTTTGCCTCATAAGCTCACCTCATCATAGGAATC
GCGGCTGGTATGCCTGCAGTTGATTACCTATGTGCGAGAGGGTCTAACATTTGTCTTGTCAAGCATTACTGGGTC
AGTTTGA

© 2022 - Robin Ohm - Utrecht University - The Netherlands

Built with Python Django and Wagtail