© 2023 - Robin Ohm - Utrecht University - The Netherlands
Built with Python Django and Wagtail
| Protein ID | AgabiH97|018510 |
| Gene name | |
| Location | scaffold_10:960297..960647 |
| Strand | - |
| Gene length (bp) | 350 |
| Transcript length (bp) | 297 |
| Coding sequence length (bp) | 297 |
| Protein length (aa) | 99 |
| Localizations | Signals | Cytoplasm | Nucleus | Extracellular | Cell membrane | Mitochondrion | Plastid | Endoplasmic reticulum | Lysosome vacuole | Golgi apparatus | Peroxisome |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Extracellular | Signal peptide | 0.4205 | 0.3046 | 0.4802 | 0.2184 | 0.2484 | 0.0182 | 0.3609 | 0.2814 | 0.1809 | 0.1756 |
| SignalP signal predicted | Location | Score |
|---|---|---|
| Yes | 1 - 16 | 0.732867 |
Expression values
| Label | Description | Expression (RPKM) | Confidence interval (low) | Confidence interval (high) |
|---|---|---|---|---|
| Casing | Casing mycelium | 0.0 | 0.0 | 0.0 |
| Initials | Initials knots | 0.0 | 0.0 | 0.0 |
| Pileal_Stipeal_center | Stage I stipe center | 0.0 | 0.0 | 0.0 |
| Pileal_Stipeal_shell | Stage I stipe shell | 0.0 | 0.0 | 0.0 |
| DIF_stipe_center | Stage II stipe center | 0.0 | 0.0 | 0.0 |
| DIF_stipe_shell | Stage II stipe shell | 0.0 | 0.0 | 0.0 |
| DIF_stipe_skin | Stage II stipe skin | 0.0 | 0.0 | 0.0 |
| DIF_cap_skin | Stage II cap skin | 0.0 | 0.0 | 0.0 |
| DIF_cap_tissue | Stage II cap tissue | 0.0 | 0.0 | 0.0 |
| DIF_gill_tissue | Stage II gill tissue | 0.0 | 0.0 | 0.0 |
| YFB_stipe_center | Young fruiting body stipe center | 0.0 | 0.0 | 0.0 |
| YFB_stipe_shell | Young fruiting body stipe shell | 0.0 | 0.0 | 0.0 |
| YFB_stipe_skin | Young fruiting body stipe skin | 0.0 | 0.0 | 0.0 |
| YFB_cap_skin | Young fruiting body cap skin | 0.0 | 0.0 | 0.0 |
| YFB_cap_tissue | Young fruiting body cap tissue | 0.0 | 0.0 | 0.0 |
| YFB_gill_tissue | Young fruiting body gill tissue | 0.0 | 0.0 | 0.0 |
| YFB_veil | Young fruiting body veil | 0.0 | 0.0 | 0.0 |
Differential expression
| Label1 | Label2 | Q-value | Significant difference |
|---|---|---|---|
| Casing | DIF_gill_tissue | 1.0 | no |
| Casing | YFB_stipe_center | 1.0 | no |
| Casing | YFB_stipe_shell | 1.0 | no |
| Casing | YFB_stipe_skin | 1.0 | no |
| Casing | YFB_cap_skin | 1.0 | no |
| Casing | YFB_cap_tissue | 1.0 | no |
| Casing | YFB_gill_tissue | 1.0 | no |
| Casing | YFB_veil | 1.0 | no |
| Casing | Initials | 1.0 | no |
| Casing | Pileal_Stipeal_center | 1.0 | no |
| Casing | Pileal_Stipeal_shell | 1.0 | no |
| Casing | DIF_stipe_center | 1.0 | no |
| Casing | DIF_stipe_shell | 1.0 | no |
| Casing | DIF_stipe_skin | 1.0 | no |
| Casing | DIF_cap_skin | 1.0 | no |
| Casing | DIF_cap_tissue | 1.0 | no |
| DIF_gill_tissue | YFB_stipe_center | 1.0 | no |
| DIF_gill_tissue | YFB_stipe_shell | 1.0 | no |
| DIF_gill_tissue | YFB_stipe_skin | 1.0 | no |
| DIF_gill_tissue | YFB_cap_skin | 1.0 | no |
| DIF_gill_tissue | YFB_cap_tissue | 1.0 | no |
| DIF_gill_tissue | YFB_gill_tissue | 1.0 | no |
| DIF_gill_tissue | YFB_veil | 1.0 | no |
| YFB_stipe_center | YFB_stipe_shell | 1.0 | no |
| YFB_stipe_center | YFB_stipe_skin | 1.0 | no |
| YFB_stipe_center | YFB_cap_skin | 1.0 | no |
| YFB_stipe_center | YFB_cap_tissue | 1.0 | no |
| YFB_stipe_center | YFB_gill_tissue | 1.0 | no |
| YFB_stipe_center | YFB_veil | 1.0 | no |
| YFB_stipe_shell | YFB_stipe_skin | 1.0 | no |
| YFB_stipe_shell | YFB_cap_skin | 1.0 | no |
| YFB_stipe_shell | YFB_cap_tissue | 1.0 | no |
| YFB_stipe_shell | YFB_gill_tissue | 1.0 | no |
| YFB_stipe_shell | YFB_veil | 1.0 | no |
| YFB_stipe_skin | YFB_cap_skin | 1.0 | no |
| YFB_stipe_skin | YFB_cap_tissue | 1.0 | no |
| YFB_stipe_skin | YFB_gill_tissue | 1.0 | no |
| YFB_stipe_skin | YFB_veil | 1.0 | no |
| YFB_cap_skin | YFB_cap_tissue | 1.0 | no |
| YFB_cap_skin | YFB_gill_tissue | 1.0 | no |
| YFB_cap_skin | YFB_veil | 1.0 | no |
| YFB_cap_tissue | YFB_gill_tissue | 1.0 | no |
| YFB_cap_tissue | YFB_veil | 1.0 | no |
| YFB_gill_tissue | YFB_veil | 1.0 | no |
| Initials | DIF_gill_tissue | 1.0 | no |
| Initials | YFB_stipe_center | 1.0 | no |
| Initials | YFB_stipe_shell | 1.0 | no |
| Initials | YFB_stipe_skin | 1.0 | no |
| Initials | YFB_cap_skin | 1.0 | no |
| Initials | YFB_cap_tissue | 1.0 | no |
| Initials | YFB_gill_tissue | 1.0 | no |
| Initials | YFB_veil | 1.0 | no |
| Initials | Pileal_Stipeal_center | 1.0 | no |
| Initials | Pileal_Stipeal_shell | 1.0 | no |
| Initials | DIF_stipe_center | 1.0 | no |
| Initials | DIF_stipe_shell | 1.0 | no |
| Initials | DIF_stipe_skin | 1.0 | no |
| Initials | DIF_cap_skin | 1.0 | no |
| Initials | DIF_cap_tissue | 1.0 | no |
| Pileal_Stipeal_center | DIF_gill_tissue | 1.0 | no |
| Pileal_Stipeal_center | YFB_stipe_center | 1.0 | no |
| Pileal_Stipeal_center | YFB_stipe_shell | 1.0 | no |
| Pileal_Stipeal_center | YFB_stipe_skin | 1.0 | no |
| Pileal_Stipeal_center | YFB_cap_skin | 1.0 | no |
| Pileal_Stipeal_center | YFB_cap_tissue | 1.0 | no |
| Pileal_Stipeal_center | YFB_gill_tissue | 1.0 | no |
| Pileal_Stipeal_center | YFB_veil | 1.0 | no |
| Pileal_Stipeal_center | Pileal_Stipeal_shell | 1.0 | no |
| Pileal_Stipeal_center | DIF_stipe_center | 1.0 | no |
| Pileal_Stipeal_center | DIF_stipe_shell | 1.0 | no |
| Pileal_Stipeal_center | DIF_stipe_skin | 1.0 | no |
| Pileal_Stipeal_center | DIF_cap_skin | 1.0 | no |
| Pileal_Stipeal_center | DIF_cap_tissue | 1.0 | no |
| Pileal_Stipeal_shell | DIF_gill_tissue | 1.0 | no |
| Pileal_Stipeal_shell | YFB_stipe_center | 1.0 | no |
| Pileal_Stipeal_shell | YFB_stipe_shell | 1.0 | no |
| Pileal_Stipeal_shell | YFB_stipe_skin | 1.0 | no |
| Pileal_Stipeal_shell | YFB_cap_skin | 1.0 | no |
| Pileal_Stipeal_shell | YFB_cap_tissue | 1.0 | no |
| Pileal_Stipeal_shell | YFB_gill_tissue | 1.0 | no |
| Pileal_Stipeal_shell | YFB_veil | 1.0 | no |
| Pileal_Stipeal_shell | DIF_stipe_center | 1.0 | no |
| Pileal_Stipeal_shell | DIF_stipe_shell | 1.0 | no |
| Pileal_Stipeal_shell | DIF_stipe_skin | 1.0 | no |
| Pileal_Stipeal_shell | DIF_cap_skin | 1.0 | no |
| Pileal_Stipeal_shell | DIF_cap_tissue | 1.0 | no |
| DIF_stipe_center | DIF_gill_tissue | 1.0 | no |
| DIF_stipe_center | YFB_stipe_center | 1.0 | no |
| DIF_stipe_center | YFB_stipe_shell | 1.0 | no |
| DIF_stipe_center | YFB_stipe_skin | 1.0 | no |
| DIF_stipe_center | YFB_cap_skin | 1.0 | no |
| DIF_stipe_center | YFB_cap_tissue | 1.0 | no |
| DIF_stipe_center | YFB_gill_tissue | 1.0 | no |
| DIF_stipe_center | YFB_veil | 1.0 | no |
| DIF_stipe_center | DIF_stipe_shell | 1.0 | no |
| DIF_stipe_center | DIF_stipe_skin | 1.0 | no |
| DIF_stipe_center | DIF_cap_skin | 1.0 | no |
| DIF_stipe_center | DIF_cap_tissue | 1.0 | no |
| DIF_stipe_shell | DIF_gill_tissue | 1.0 | no |
| DIF_stipe_shell | YFB_stipe_center | 1.0 | no |
| DIF_stipe_shell | YFB_stipe_shell | 1.0 | no |
| DIF_stipe_shell | YFB_stipe_skin | 1.0 | no |
| DIF_stipe_shell | YFB_cap_skin | 1.0 | no |
| DIF_stipe_shell | YFB_cap_tissue | 1.0 | no |
| DIF_stipe_shell | YFB_gill_tissue | 1.0 | no |
| DIF_stipe_shell | YFB_veil | 1.0 | no |
| DIF_stipe_shell | DIF_stipe_skin | 1.0 | no |
| DIF_stipe_shell | DIF_cap_skin | 1.0 | no |
| DIF_stipe_shell | DIF_cap_tissue | 1.0 | no |
| DIF_stipe_skin | DIF_gill_tissue | 1.0 | no |
| DIF_stipe_skin | YFB_stipe_center | 1.0 | no |
| DIF_stipe_skin | YFB_stipe_shell | 1.0 | no |
| DIF_stipe_skin | YFB_stipe_skin | 1.0 | no |
| DIF_stipe_skin | YFB_cap_skin | 1.0 | no |
| DIF_stipe_skin | YFB_cap_tissue | 1.0 | no |
| DIF_stipe_skin | YFB_gill_tissue | 1.0 | no |
| DIF_stipe_skin | YFB_veil | 1.0 | no |
| DIF_stipe_skin | DIF_cap_skin | 1.0 | no |
| DIF_stipe_skin | DIF_cap_tissue | 1.0 | no |
| DIF_cap_skin | DIF_gill_tissue | 1.0 | no |
| DIF_cap_skin | YFB_stipe_center | 1.0 | no |
| DIF_cap_skin | YFB_stipe_shell | 1.0 | no |
| DIF_cap_skin | YFB_stipe_skin | 1.0 | no |
| DIF_cap_skin | YFB_cap_skin | 1.0 | no |
| DIF_cap_skin | YFB_cap_tissue | 1.0 | no |
| DIF_cap_skin | YFB_gill_tissue | 1.0 | no |
| DIF_cap_skin | YFB_veil | 1.0 | no |
| DIF_cap_skin | DIF_cap_tissue | 1.0 | no |
| DIF_cap_tissue | DIF_gill_tissue | 1.0 | no |
| DIF_cap_tissue | YFB_stipe_center | 1.0 | no |
| DIF_cap_tissue | YFB_stipe_shell | 1.0 | no |
| DIF_cap_tissue | YFB_stipe_skin | 1.0 | no |
| DIF_cap_tissue | YFB_cap_skin | 1.0 | no |
| DIF_cap_tissue | YFB_cap_tissue | 1.0 | no |
| DIF_cap_tissue | YFB_gill_tissue | 1.0 | no |
| DIF_cap_tissue | YFB_veil | 1.0 | no |
| Orthofinder run ID | 1 |
| Orthogroup | 12075 |
| Change Orthofinder run |
| Species | Protein ID |
|---|---|
| Agaricus bisporus var bisporus H39 | AgabiH39|018510 |
| Agaricus bisporus var bisporus H97 | AgabiH97|018510 (this protein) |
| Type of sequence | Sequence |
|---|---|
| Locus | Download genbank file of locus
Download genbank file of locus (reverse complement)
The gene with 5 kb flanks (if sufficient flanking sequence is available). For use in cloning design programs. NOTE: features (genes or exons) that are only partially contained within the sequence are completely excluded. |
| Protein | >AgabiH97|018510 MLILFLVALHLPLIANDVQRIYSSLHATDIAINKVAPHLLMTTIINNLLHLSVKGVVLATGTSILFVVSNLHSAP APIVTRRSQYPLVMVIIKIKSYN* |
| Coding | >AgabiH97|018510 ATGCTCATTCTATTTCTAGTGGCCCTTCATCTTCCCCTCATCGCAAACGACGTCCAAAGGATCTATTCAAGTCTT CACGCCACAGATATAGCCATAAACAAAGTCGCTCCTCATCTCCTTATGACCACCATCATCAACAATCTTCTTCAC CTATCCGTCAAAGGCGTCGTATTGGCCACGGGCACGAGCATCCTCTTTGTCGTGTCAAATCTTCACAGCGCTCCA GCACCCATCGTCACTCGAAGAAGCCAATATCCTCTTGTTATGGTGATAATTAAAATCAAGTCCTACAACTAG |
| Transcript | >AgabiH97|018510 ATGCTCATTCTATTTCTAGTGGCCCTTCATCTTCCCCTCATCGCAAACGACGTCCAAAGGATCTATTCAAGTCTT CACGCCACAGATATAGCCATAAACAAAGTCGCTCCTCATCTCCTTATGACCACCATCATCAACAATCTTCTTCAC CTATCCGTCAAAGGCGTCGTATTGGCCACGGGCACGAGCATCCTCTTTGTCGTGTCAAATCTTCACAGCGCTCCA GCACCCATCGTCACTCGAAGAAGCCAATATCCTCTTGTTATGGTGATAATTAAAATCAAGTCCTACAACTAG |
| Gene | >AgabiH97|018510 ATGCTCATTCTATTTCTAGTGGCCCTTCATCTTCCCCTCATCGCAAACGACGTCCAAAGGATCTATTCAAGTCTT CACGCCACAGATATAGCCATAAACAAAGTCGCTCCTCATCTCCTTATGACCACCATCATCAACAATCTTCTTCAC CTATCCGTCAAAGGCGTCGTATTGGCCACGGGCACGAGCATCCTCTTTGTCGTGTCAAATCTTCACAGCGCTCCA GCACCCATCGTCACTCGAAGAAGCCAATATCCTCTTGTTATGGTGATAATTAAAATCAGTAAGTTATTTCTATTG TTGACTTTCATTTACTGATACTTATTAGCTTGATAGAGTCCTACAACTAG |